Incidental Mutation 'R3768:Usp36'
ID 273131
Institutional Source Beutler Lab
Gene Symbol Usp36
Ensembl Gene ENSMUSG00000033909
Gene Name ubiquitin specific peptidase 36
Synonyms 2700002L06Rik
MMRRC Submission 040745-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R3768 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 118150477-118181070 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118153878 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 846 (K846R)
Ref Sequence ENSEMBL: ENSMUSP00000122761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]
AlphaFold B1AQJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000092382
AA Change: K1011R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: K1011R

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.6e-55 PFAM
Pfam:UCH_1 122 402 3.6e-26 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106296
AA Change: K1011R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: K1011R

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.1e-49 PFAM
Pfam:UCH_1 122 402 2.2e-23 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141647
Predicted Effect probably damaging
Transcript: ENSMUST00000144153
AA Change: K846R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909
AA Change: K846R

DomainStartEndE-ValueType
Pfam:UCH 1 255 1e-40 PFAM
Pfam:UCH_1 4 237 2.9e-17 PFAM
low complexity region 375 393 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 768 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148998
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T C 11: 110,204,217 (GRCm39) R353G probably benign Het
Ank1 A G 8: 23,606,202 (GRCm39) D1153G possibly damaging Het
Ankrd12 T C 17: 66,292,715 (GRCm39) Y906C probably benign Het
Apol9a G C 15: 77,288,596 (GRCm39) T257S probably benign Het
Arhgap23 A T 11: 97,366,932 (GRCm39) D1071V probably damaging Het
Arid4a A G 12: 71,113,893 (GRCm39) K160R probably damaging Het
Atp8a2 T A 14: 60,281,785 (GRCm39) H142L probably benign Het
B3gnt2 T C 11: 22,786,765 (GRCm39) K141R probably damaging Het
Btbd7 G A 12: 102,761,451 (GRCm39) P578L probably damaging Het
C3 C T 17: 57,512,303 (GRCm39) D1542N possibly damaging Het
Cmya5 A T 13: 93,233,201 (GRCm39) I629K possibly damaging Het
Cnga4 A G 7: 105,056,887 (GRCm39) N330S probably damaging Het
Cplx4 T C 18: 66,102,998 (GRCm39) T41A probably benign Het
Cxcl15 A C 5: 90,949,303 (GRCm39) D156A unknown Het
D630045J12Rik A G 6: 38,119,844 (GRCm39) S1633P probably damaging Het
Dock10 T A 1: 80,510,085 (GRCm39) N1581I probably damaging Het
Dock7 T C 4: 98,859,066 (GRCm39) T1409A probably benign Het
Dscaml1 T A 9: 45,643,435 (GRCm39) F1285I possibly damaging Het
Fgf10 G T 13: 118,918,083 (GRCm39) V124F probably damaging Het
Ifna7 T C 4: 88,734,964 (GRCm39) V167A probably damaging Het
Kctd19 T C 8: 106,123,112 (GRCm39) T101A probably benign Het
Klf3 A G 5: 64,984,560 (GRCm39) probably null Het
Krtap12-1 G T 10: 77,556,729 (GRCm39) V91L probably benign Het
Lrp2 C T 2: 69,335,449 (GRCm39) D1425N probably benign Het
Mgl2 T C 11: 70,026,659 (GRCm39) L128P probably damaging Het
Mypn C A 10: 62,961,486 (GRCm39) L1035F possibly damaging Het
Ncor2 A G 5: 125,105,751 (GRCm39) V1613A probably damaging Het
Nlgn2 C T 11: 69,719,230 (GRCm39) V207I possibly damaging Het
Or10v1 G A 19: 11,873,676 (GRCm39) G97D probably damaging Het
Or1ad6 A G 11: 50,860,385 (GRCm39) D180G probably damaging Het
Or2y14 T C 11: 49,404,600 (GRCm39) I45T probably damaging Het
Or4d10c A G 19: 12,065,304 (GRCm39) I284T probably damaging Het
Osbpl3 G A 6: 50,324,982 (GRCm39) P172L possibly damaging Het
Pabpc4 T A 4: 123,188,405 (GRCm39) V338D probably damaging Het
Pdia6 T C 12: 17,320,457 (GRCm39) V32A probably damaging Het
Pik3c3 T A 18: 30,466,326 (GRCm39) S792R probably damaging Het
Pla2g5 C G 4: 138,528,746 (GRCm39) C70S probably damaging Het
Pole4 G A 6: 82,599,095 (GRCm39) R119C possibly damaging Het
Ppm1h G T 10: 122,740,027 (GRCm39) L367F probably damaging Het
Ptpru C T 4: 131,535,735 (GRCm39) C414Y probably damaging Het
Rhot2 T C 17: 26,059,521 (GRCm39) D407G probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sap25 T A 5: 137,640,632 (GRCm39) F171I probably damaging Het
Serpinb11 T C 1: 107,305,392 (GRCm39) probably null Het
Tarm1 A T 7: 3,546,097 (GRCm39) S69T probably benign Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Zfp229 A T 17: 21,964,844 (GRCm39) H358L probably damaging Het
Zfp747l1 A G 7: 126,984,035 (GRCm39) probably benign Het
Other mutations in Usp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Usp36 APN 11 118,155,646 (GRCm39) missense possibly damaging 0.76
IGL01115:Usp36 APN 11 118,176,786 (GRCm39) missense probably damaging 1.00
IGL01720:Usp36 APN 11 118,165,828 (GRCm39) missense probably damaging 0.99
IGL02410:Usp36 APN 11 118,167,011 (GRCm39) missense probably damaging 1.00
IGL02700:Usp36 APN 11 118,166,983 (GRCm39) missense possibly damaging 0.95
IGL02926:Usp36 APN 11 118,155,609 (GRCm39) missense probably benign 0.22
IGL03145:Usp36 APN 11 118,170,067 (GRCm39) missense probably damaging 1.00
IGL03203:Usp36 APN 11 118,176,636 (GRCm39) missense probably benign 0.42
IGL03265:Usp36 APN 11 118,155,635 (GRCm39) missense possibly damaging 0.65
R0482:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R0499:Usp36 UTSW 11 118,164,397 (GRCm39) missense probably damaging 0.98
R0606:Usp36 UTSW 11 118,153,854 (GRCm39) splice site probably benign
R0646:Usp36 UTSW 11 118,163,847 (GRCm39) missense probably damaging 1.00
R1579:Usp36 UTSW 11 118,175,771 (GRCm39) missense probably damaging 1.00
R1646:Usp36 UTSW 11 118,164,392 (GRCm39) missense probably damaging 1.00
R1716:Usp36 UTSW 11 118,162,957 (GRCm39) critical splice donor site probably null
R1886:Usp36 UTSW 11 118,163,784 (GRCm39) missense probably damaging 1.00
R2014:Usp36 UTSW 11 118,153,334 (GRCm39) splice site probably benign
R2068:Usp36 UTSW 11 118,165,844 (GRCm39) missense possibly damaging 0.80
R2146:Usp36 UTSW 11 118,159,491 (GRCm39) missense probably benign 0.02
R2191:Usp36 UTSW 11 118,175,849 (GRCm39) missense possibly damaging 0.95
R2899:Usp36 UTSW 11 118,167,582 (GRCm39) splice site probably benign
R3176:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3177:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3276:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3277:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3615:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3616:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3899:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R3900:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R4484:Usp36 UTSW 11 118,176,621 (GRCm39) missense probably damaging 0.99
R4809:Usp36 UTSW 11 118,153,896 (GRCm39) missense probably damaging 1.00
R5135:Usp36 UTSW 11 118,155,731 (GRCm39) missense possibly damaging 0.58
R5323:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R6226:Usp36 UTSW 11 118,168,100 (GRCm39) missense probably damaging 1.00
R6266:Usp36 UTSW 11 118,159,411 (GRCm39) missense probably damaging 1.00
R7191:Usp36 UTSW 11 118,159,660 (GRCm39) missense probably benign 0.39
R7215:Usp36 UTSW 11 118,155,980 (GRCm39) missense possibly damaging 0.87
R7289:Usp36 UTSW 11 118,164,355 (GRCm39) missense probably damaging 1.00
R7535:Usp36 UTSW 11 118,152,872 (GRCm39) missense possibly damaging 0.92
R7675:Usp36 UTSW 11 118,154,522 (GRCm39) missense probably benign 0.11
R7843:Usp36 UTSW 11 118,176,791 (GRCm39) missense probably damaging 1.00
R8228:Usp36 UTSW 11 118,155,716 (GRCm39) missense possibly damaging 0.77
R8902:Usp36 UTSW 11 118,165,840 (GRCm39) missense probably damaging 1.00
R8935:Usp36 UTSW 11 118,167,657 (GRCm39) critical splice acceptor site probably null
R8995:Usp36 UTSW 11 118,175,825 (GRCm39) missense probably damaging 1.00
R9024:Usp36 UTSW 11 118,166,983 (GRCm39) missense possibly damaging 0.95
R9325:Usp36 UTSW 11 118,160,031 (GRCm39) missense possibly damaging 0.69
R9529:Usp36 UTSW 11 118,159,461 (GRCm39) nonsense probably null
R9774:Usp36 UTSW 11 118,153,875 (GRCm39) missense probably damaging 1.00
X0020:Usp36 UTSW 11 118,164,439 (GRCm39) missense probably damaging 1.00
Z1177:Usp36 UTSW 11 118,167,026 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAACTCCGCTGGCTTGTG -3'
(R):5'- ATCACCAGAGAGTGAGTGTCTGC -3'

Sequencing Primer
(F):5'- CTGGCTTGTGGTCCCCATG -3'
(R):5'- TGAGTGTCTGCTGGCACCAG -3'
Posted On 2015-03-25