Mutagenetix > Incidental Mutation

Incidental Mutation 'R3768:Usp36'

273131

Institutional Source

Beutler Lab

Gene Symbol

Usp36

Ensembl Gene

ENSMUSG00000033909

Gene Name

ubiquitin specific peptidase 36

Synonyms

2700002L06Rik

MMRRC Submission

040745-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R3768 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118259651-118290244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118263052 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 846 (K846R)

Ref Sequence

ENSEMBL: ENSMUSP00000122761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]

AlphaFold

B1AQJ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000092382
AA Change: K1011R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: K1011R

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.6e-55	PFAM
Pfam:UCH_1	122	402	3.6e-26	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106296
AA Change: K1011R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: K1011R

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.1e-49	PFAM
Pfam:UCH_1	122	402	2.2e-23	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141647

Predicted Effect

probably damaging
Transcript: ENSMUST00000144153
AA Change: K846R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909
AA Change: K846R

Domain	Start	End	E-Value	Type
Pfam:UCH	1	255	1e-40	PFAM
Pfam:UCH_1	4	237	2.9e-17	PFAM
low complexity region	375	393	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	579	598	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	768	778	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148998

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	A	G	7: 127,384,863		probably benign	Het
Abca5	T	C	11: 110,313,391	R353G	probably benign	Het
Ank1	A	G	8: 23,116,186	D1153G	possibly damaging	Het
Ankrd12	T	C	17: 65,985,720	Y906C	probably benign	Het
Apol9a	G	C	15: 77,404,396	T257S	probably benign	Het
Arhgap23	A	T	11: 97,476,106	D1071V	probably damaging	Het
Arid4a	A	G	12: 71,067,119	K160R	probably damaging	Het
Atp8a2	T	A	14: 60,044,336	H142L	probably benign	Het
B3gnt2	T	C	11: 22,836,765	K141R	probably damaging	Het
Btbd7	G	A	12: 102,795,192	P578L	probably damaging	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cmya5	A	T	13: 93,096,693	I629K	possibly damaging	Het
Cnga4	A	G	7: 105,407,680	N330S	probably damaging	Het
Cplx4	T	C	18: 65,969,927	T41A	probably benign	Het
Cxcl15	A	C	5: 90,801,444	D156A	unknown	Het
D630045J12Rik	A	G	6: 38,142,909	S1633P	probably damaging	Het
Dock10	T	A	1: 80,532,368	N1581I	probably damaging	Het
Dock7	T	C	4: 98,970,829	T1409A	probably benign	Het
Dscaml1	T	A	9: 45,732,137	F1285I	possibly damaging	Het
Fgf10	G	T	13: 118,781,547	V124F	probably damaging	Het
Ifna7	T	C	4: 88,816,727	V167A	probably damaging	Het
Kctd19	T	C	8: 105,396,480	T101A	probably benign	Het
Klf3	A	G	5: 64,827,217		probably null	Het
Krtap12-1	G	T	10: 77,720,895	V91L	probably benign	Het
Lrp2	C	T	2: 69,505,105	D1425N	probably benign	Het
Mgl2	T	C	11: 70,135,833	L128P	probably damaging	Het
Mypn	C	A	10: 63,125,707	L1035F	possibly damaging	Het
Ncor2	A	G	5: 125,028,687	V1613A	probably damaging	Het
Nlgn2	C	T	11: 69,828,404	V207I	possibly damaging	Het
Olfr1378	A	G	11: 50,969,558	D180G	probably damaging	Het
Olfr1384	T	C	11: 49,513,773	I45T	probably damaging	Het
Olfr1420	G	A	19: 11,896,312	G97D	probably damaging	Het
Olfr1426	A	G	19: 12,087,940	I284T	probably damaging	Het
Osbpl3	G	A	6: 50,348,002	P172L	possibly damaging	Het
Pabpc4	T	A	4: 123,294,612	V338D	probably damaging	Het
Pdia6	T	C	12: 17,270,456	V32A	probably damaging	Het
Pik3c3	T	A	18: 30,333,273	S792R	probably damaging	Het
Pla2g5	C	G	4: 138,801,435	C70S	probably damaging	Het
Pole4	G	A	6: 82,622,114	R119C	possibly damaging	Het
Ppm1h	G	T	10: 122,904,122	L367F	probably damaging	Het
Ptpru	C	T	4: 131,808,424	C414Y	probably damaging	Het
Rhot2	T	C	17: 25,840,547	D407G	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sap25	T	A	5: 137,642,370	F171I	probably damaging	Het
Serpinb11	T	C	1: 107,377,662		probably null	Het
Tarm1	A	T	7: 3,497,581	S69T	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Zfp229	A	T	17: 21,745,863	H358L	probably damaging	Het

Other mutations in Usp36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Usp36	APN	11	118264820	missense	possibly damaging	0.76
IGL01115:Usp36	APN	11	118285960	missense	probably damaging	1.00
IGL01720:Usp36	APN	11	118275002	missense	probably damaging	0.99
IGL02410:Usp36	APN	11	118276185	missense	probably damaging	1.00
IGL02700:Usp36	APN	11	118276157	missense	possibly damaging	0.95
IGL02926:Usp36	APN	11	118264783	missense	probably benign	0.22
IGL03145:Usp36	APN	11	118279241	missense	probably damaging	1.00
IGL03203:Usp36	APN	11	118285810	missense	probably benign	0.42
IGL03265:Usp36	APN	11	118264809	missense	possibly damaging	0.65
R0482:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R0499:Usp36	UTSW	11	118273571	missense	probably damaging	0.98
R0606:Usp36	UTSW	11	118263028	splice site	probably benign
R0646:Usp36	UTSW	11	118273021	missense	probably damaging	1.00
R1579:Usp36	UTSW	11	118284945	missense	probably damaging	1.00
R1646:Usp36	UTSW	11	118273566	missense	probably damaging	1.00
R1716:Usp36	UTSW	11	118272131	critical splice donor site	probably null
R1886:Usp36	UTSW	11	118272958	missense	probably damaging	1.00
R2014:Usp36	UTSW	11	118262508	splice site	probably benign
R2068:Usp36	UTSW	11	118275018	missense	possibly damaging	0.80
R2146:Usp36	UTSW	11	118268665	missense	probably benign	0.02
R2191:Usp36	UTSW	11	118285023	missense	possibly damaging	0.95
R2899:Usp36	UTSW	11	118276756	splice site	probably benign
R3176:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3177:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3276:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3277:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3615:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3616:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3899:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R3900:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R4484:Usp36	UTSW	11	118285795	missense	probably damaging	0.99
R4809:Usp36	UTSW	11	118263070	missense	probably damaging	1.00
R5135:Usp36	UTSW	11	118264905	missense	possibly damaging	0.58
R5323:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R6226:Usp36	UTSW	11	118277274	missense	probably damaging	1.00
R6266:Usp36	UTSW	11	118268585	missense	probably damaging	1.00
R7191:Usp36	UTSW	11	118268834	missense	probably benign	0.39
R7215:Usp36	UTSW	11	118265154	missense	possibly damaging	0.87
R7289:Usp36	UTSW	11	118273529	missense	probably damaging	1.00
R7535:Usp36	UTSW	11	118262046	missense	possibly damaging	0.92
R7675:Usp36	UTSW	11	118263696	missense	probably benign	0.11
R7843:Usp36	UTSW	11	118285965	missense	probably damaging	1.00
R8228:Usp36	UTSW	11	118264890	missense	possibly damaging	0.77
R8902:Usp36	UTSW	11	118275014	missense	probably damaging	1.00
R8935:Usp36	UTSW	11	118276831	critical splice acceptor site	probably null
R8995:Usp36	UTSW	11	118284999	missense	probably damaging	1.00
R9024:Usp36	UTSW	11	118276157	missense	possibly damaging	0.95
R9325:Usp36	UTSW	11	118269205	missense	possibly damaging	0.69
R9529:Usp36	UTSW	11	118268635	nonsense	probably null
R9774:Usp36	UTSW	11	118263049	missense	probably damaging	1.00
X0020:Usp36	UTSW	11	118273613	missense	probably damaging	1.00
Z1177:Usp36	UTSW	11	118276200	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTAACTCCGCTGGCTTGTG -3'
(R):5'- ATCACCAGAGAGTGAGTGTCTGC -3'

Sequencing Primer
(F):5'- CTGGCTTGTGGTCCCCATG -3'
(R):5'- TGAGTGTCTGCTGGCACCAG -3'

Posted On

2015-03-25