Incidental Mutation 'R3769:Chst5'
ID273170
Institutional Source Beutler Lab
Gene Symbol Chst5
Ensembl Gene ENSMUSG00000031952
Gene Namecarbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
SynonymsGST-4, I-GlcNAc6ST
MMRRC Submission 040746-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3769 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111889136-111910447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111889881 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 369 (D369V)
Ref Sequence ENSEMBL: ENSMUSP00000034430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034430]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034430
AA Change: D369V

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034430
Gene: ENSMUSG00000031952
AA Change: D369V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Sulfotransfer_1 40 357 1.2e-25 PFAM
Pfam:Sulfotransfer_3 41 294 4.7e-16 PFAM
low complexity region 363 376 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the transfer of a sulfate group to the GlcNAc residues of keratan. Keratan sulfate helps maintain corneal transparency. Defects in this gene are a cause of macular corneal dystrophy (MCD). [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in thinner corneas that show abnormally close collagen fibrillar packing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Ccer1 G A 10: 97,694,552 G359E probably damaging Het
Cdkal1 T C 13: 29,552,403 probably null Het
Celf1 T C 2: 90,998,648 V20A probably damaging Het
Cep350 G A 1: 155,953,204 T318I probably damaging Het
Chn2 A G 6: 54,290,411 D159G probably damaging Het
Cmya5 A T 13: 93,096,693 I629K possibly damaging Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Ddx3x T C X: 13,290,569 probably benign Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Dpy19l4 T C 4: 11,276,868 probably null Het
Fgf10 G T 13: 118,781,547 V124F probably damaging Het
Gm6356 C A 14: 6,971,774 M120I probably benign Het
Gm7964 T A 7: 83,756,130 V76D probably damaging Het
Gm826 A G 2: 160,327,245 V48A unknown Het
Hoxb5 A G 11: 96,303,969 D119G possibly damaging Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Itgb2 T C 10: 77,549,968 V255A possibly damaging Het
Klf3 A G 5: 64,827,217 probably null Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Pdia6 T C 12: 17,270,456 V32A probably damaging Het
Pex6 G T 17: 46,724,385 probably null Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Polr2c G A 8: 94,860,300 A65T probably damaging Het
Ppil2 T C 16: 17,109,668 H20R probably benign Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Scn5a G A 9: 119,552,076 probably benign Het
Sh3rf3 A G 10: 58,984,191 T275A probably benign Het
Slc27a2 A G 2: 126,567,798 D300G possibly damaging Het
Slc35e1 A T 8: 72,491,870 I155N possibly damaging Het
Slco1a4 A G 6: 141,839,631 Y78H probably damaging Het
Snx15 T A 19: 6,123,954 probably benign Het
Top1 A T 2: 160,721,522 I758F probably damaging Het
U2surp A G 9: 95,493,697 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A G 9: 121,263,700 V157A probably benign Het
Urgcp T C 11: 5,717,000 Y446C probably damaging Het
Vps51 T C 19: 6,076,348 T125A possibly damaging Het
Zfp458 T A 13: 67,257,482 I298F probably damaging Het
Other mutations in Chst5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Chst5 APN 8 111890682 missense probably damaging 1.00
IGL02336:Chst5 APN 8 111890317 missense probably damaging 0.99
IGL02634:Chst5 APN 8 111890845 missense probably damaging 1.00
R0606:Chst5 UTSW 8 111890919 missense probably benign 0.05
R1552:Chst5 UTSW 8 111890280 missense probably damaging 0.99
R2094:Chst5 UTSW 8 111890544 missense probably benign 0.01
R4135:Chst5 UTSW 8 111890184 missense probably damaging 1.00
R4872:Chst5 UTSW 8 111890560 missense possibly damaging 0.61
R5658:Chst5 UTSW 8 111890790 missense probably damaging 1.00
R5759:Chst5 UTSW 8 111890210 missense probably benign 0.25
R5893:Chst5 UTSW 8 111890196 missense probably damaging 1.00
R6657:Chst5 UTSW 8 111890274 missense probably benign 0.00
R6731:Chst5 UTSW 8 111890044 missense probably benign 0.00
R7406:Chst5 UTSW 8 111890613 missense probably benign 0.00
R7535:Chst5 UTSW 8 111890163 missense probably damaging 1.00
R7727:Chst5 UTSW 8 111890925 missense probably benign 0.25
R7835:Chst5 UTSW 8 111890602 missense probably damaging 1.00
R7843:Chst5 UTSW 8 111890572 missense probably benign 0.00
R8257:Chst5 UTSW 8 111890460 missense probably damaging 1.00
R8324:Chst5 UTSW 8 111890508 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGACTCCATCCTTTCCTAGTACAG -3'
(R):5'- AATATCACGCATGGTTCAGGG -3'

Sequencing Primer
(F):5'- GATCACTCACACTCCCAGCTACTTG -3'
(R):5'- ATGGTTCAGGGCCAGGC -3'
Posted On2015-03-25