Incidental Mutation 'R3769:Sh3rf3'
ID273174
Institutional Source Beutler Lab
Gene Symbol Sh3rf3
Ensembl Gene ENSMUSG00000037990
Gene NameSH3 domain containing ring finger 3
SynonymsSh3md4, 4831416G18Rik
MMRRC Submission 040746-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R3769 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location58813359-59138916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58984191 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 275 (T275A)
Ref Sequence ENSEMBL: ENSMUSP00000120938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135526] [ENSMUST00000153031]
AlphaFold Q8C120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133151
Predicted Effect probably benign
Transcript: ENSMUST00000135526
AA Change: T275A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000114368
Gene: ENSMUSG00000037990
AA Change: T275A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
RING 52 92 2.76e-7 SMART
low complexity region 119 152 N/A INTRINSIC
low complexity region 161 170 N/A INTRINSIC
SH3 190 245 8.24e-18 SMART
SH3 252 311 5.56e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153031
AA Change: T275A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120938
Gene: ENSMUSG00000037990
AA Change: T275A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
RING 52 92 2.76e-7 SMART
low complexity region 119 152 N/A INTRINSIC
low complexity region 161 170 N/A INTRINSIC
SH3 190 245 8.24e-18 SMART
SH3 252 311 5.56e-15 SMART
SH3 461 518 1.43e-17 SMART
low complexity region 707 739 N/A INTRINSIC
SH3 822 878 5.19e-15 SMART
Meta Mutation Damage Score 0.0789 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Ccer1 G A 10: 97,694,552 G359E probably damaging Het
Cdkal1 T C 13: 29,552,403 probably null Het
Celf1 T C 2: 90,998,648 V20A probably damaging Het
Cep350 G A 1: 155,953,204 T318I probably damaging Het
Chn2 A G 6: 54,290,411 D159G probably damaging Het
Chst5 T A 8: 111,889,881 D369V possibly damaging Het
Cmya5 A T 13: 93,096,693 I629K possibly damaging Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Ddx3x T C X: 13,290,569 probably benign Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Dpy19l4 T C 4: 11,276,868 probably null Het
Fgf10 G T 13: 118,781,547 V124F probably damaging Het
Gm6356 C A 14: 6,971,774 M120I probably benign Het
Gm7964 T A 7: 83,756,130 V76D probably damaging Het
Gm826 A G 2: 160,327,245 V48A unknown Het
Hoxb5 A G 11: 96,303,969 D119G possibly damaging Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Itgb2 T C 10: 77,549,968 V255A possibly damaging Het
Klf3 A G 5: 64,827,217 probably null Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Pdia6 T C 12: 17,270,456 V32A probably damaging Het
Pex6 G T 17: 46,724,385 probably null Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Polr2c G A 8: 94,860,300 A65T probably damaging Het
Ppil2 T C 16: 17,109,668 H20R probably benign Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Scn5a G A 9: 119,552,076 probably benign Het
Slc27a2 A G 2: 126,567,798 D300G possibly damaging Het
Slc35e1 A T 8: 72,491,870 I155N possibly damaging Het
Slco1a4 A G 6: 141,839,631 Y78H probably damaging Het
Snx15 T A 19: 6,123,954 probably benign Het
Top1 A T 2: 160,721,522 I758F probably damaging Het
U2surp A G 9: 95,493,697 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A G 9: 121,263,700 V157A probably benign Het
Urgcp T C 11: 5,717,000 Y446C probably damaging Het
Vps51 T C 19: 6,076,348 T125A possibly damaging Het
Zfp458 T A 13: 67,257,482 I298F probably damaging Het
Other mutations in Sh3rf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Sh3rf3 APN 10 59049356 missense probably benign 0.06
IGL01898:Sh3rf3 APN 10 59049530 missense probably damaging 0.99
IGL02108:Sh3rf3 APN 10 59135828 missense probably damaging 1.00
IGL02148:Sh3rf3 APN 10 59086740 missense probably benign 0.02
exasperated UTSW 10 59086824 missense probably benign 0.06
strained UTSW 10 59007103 missense probably damaging 1.00
R0421:Sh3rf3 UTSW 10 58984075 missense probably damaging 1.00
R1056:Sh3rf3 UTSW 10 59007082 missense probably damaging 1.00
R1313:Sh3rf3 UTSW 10 59071999 missense possibly damaging 0.92
R1313:Sh3rf3 UTSW 10 59071999 missense possibly damaging 0.92
R1615:Sh3rf3 UTSW 10 59131077 missense probably benign 0.02
R1797:Sh3rf3 UTSW 10 59086667 nonsense probably null
R1869:Sh3rf3 UTSW 10 59083513 missense probably damaging 1.00
R1924:Sh3rf3 UTSW 10 59104167 splice site probably benign
R1968:Sh3rf3 UTSW 10 58813987 missense probably benign 0.32
R2353:Sh3rf3 UTSW 10 59007073 missense probably damaging 1.00
R3617:Sh3rf3 UTSW 10 59086863 missense possibly damaging 0.83
R4059:Sh3rf3 UTSW 10 59083533 missense probably damaging 1.00
R4425:Sh3rf3 UTSW 10 59083576 missense probably benign 0.00
R4690:Sh3rf3 UTSW 10 58813704 missense possibly damaging 0.93
R4832:Sh3rf3 UTSW 10 58814083 missense probably benign 0.19
R4853:Sh3rf3 UTSW 10 59083519 missense probably damaging 1.00
R4854:Sh3rf3 UTSW 10 58813723 missense possibly damaging 0.93
R4917:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R4918:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R4995:Sh3rf3 UTSW 10 59086824 missense probably benign 0.06
R5125:Sh3rf3 UTSW 10 59131190 missense probably benign 0.14
R5640:Sh3rf3 UTSW 10 58813947 missense probably benign
R5716:Sh3rf3 UTSW 10 59131283 missense probably benign 0.03
R5756:Sh3rf3 UTSW 10 59104382 missense probably damaging 0.98
R5848:Sh3rf3 UTSW 10 58984153 missense possibly damaging 0.54
R5908:Sh3rf3 UTSW 10 59049448 missense probably benign 0.32
R5930:Sh3rf3 UTSW 10 59130986 missense probably damaging 1.00
R6036:Sh3rf3 UTSW 10 58813984 missense probably benign 0.19
R6036:Sh3rf3 UTSW 10 58813984 missense probably benign 0.19
R6392:Sh3rf3 UTSW 10 59007076 missense probably damaging 0.97
R6450:Sh3rf3 UTSW 10 58984144 missense probably damaging 1.00
R6470:Sh3rf3 UTSW 10 58983969 missense probably damaging 1.00
R6639:Sh3rf3 UTSW 10 59083467 missense probably damaging 1.00
R6685:Sh3rf3 UTSW 10 59086841 missense possibly damaging 0.95
R7292:Sh3rf3 UTSW 10 59071973 missense probably damaging 1.00
R7789:Sh3rf3 UTSW 10 59086815 missense probably benign 0.01
R7941:Sh3rf3 UTSW 10 59007061 missense probably damaging 0.99
R7959:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R8140:Sh3rf3 UTSW 10 59049355 missense possibly damaging 0.88
R8142:Sh3rf3 UTSW 10 59049383 nonsense probably null
R8241:Sh3rf3 UTSW 10 59104420 missense probably benign 0.11
R8406:Sh3rf3 UTSW 10 59083585 missense probably damaging 1.00
R8725:Sh3rf3 UTSW 10 59104170 critical splice acceptor site probably null
R8727:Sh3rf3 UTSW 10 59104170 critical splice acceptor site probably null
RF020:Sh3rf3 UTSW 10 58813768 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATCATCATCCTGAGACGCAAGG -3'
(R):5'- TCCTCTTAGGAGTTGTCATTCACAC -3'

Sequencing Primer
(F):5'- TCATCCTGAGACGCAAGGTTGAC -3'
(R):5'- GAGTTGTCATTCACACAAGCAAAATC -3'
Posted On2015-03-25