Incidental Mutation 'R3770:Pla2g5'
ID273207
Institutional Source Beutler Lab
Gene Symbol Pla2g5
Ensembl Gene ENSMUSG00000041193
Gene Namephospholipase A2, group V
SynonymssPLA2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R3770 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location138799244-138863482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 138801435 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 70 (C70S)
Ref Sequence ENSEMBL: ENSMUSP00000099571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030524] [ENSMUST00000102511] [ENSMUST00000102512] [ENSMUST00000102513]
Predicted Effect probably damaging
Transcript: ENSMUST00000030524
AA Change: C70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030524
Gene: ENSMUSG00000041193
AA Change: C70S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102511
AA Change: C70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099569
Gene: ENSMUSG00000041193
AA Change: C70S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102512
AA Change: C70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099570
Gene: ENSMUSG00000041193
AA Change: C70S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102513
AA Change: C70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099571
Gene: ENSMUSG00000041193
AA Change: C70S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154844
Meta Mutation Damage Score 0.9545 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the secretory phospholipase A2 family. It is located in a tightly-linked cluster of secretory phospholipase A2 genes on chromosome 1. The encoded enzyme catalyzes the hydrolysis of membrane phospholipids to generate lysophospholipids and free fatty acids including arachidonic acid. It preferentially hydrolyzes linoleoyl-containing phosphatidylcholine substrates. Secretion of this enzyme is thought to induce inflammatory responses in neighboring cells. Alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced acute zymosan-induced peritonitis and arachadonic acid metabolite release from stimulated peritoneal macrophages. Mice homozygous for a different knock-out allele exhibit reduced response to myocardial ischemia/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Acox1 T C 11: 116,174,387 D578G probably damaging Het
Adgrb1 T A 15: 74,588,308 I543N probably damaging Het
Agbl1 T C 7: 76,425,929 probably null Het
Ano1 A G 7: 144,595,569 Y852H probably damaging Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Atp1a1 T C 3: 101,581,194 D842G probably benign Het
Brd7 A T 8: 88,339,407 probably null Het
Btbd7 G A 12: 102,795,192 P578L probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cfap54 C T 10: 92,878,536 M2660I unknown Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exoc3l4 A G 12: 111,425,555 D410G probably benign Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,260,491 probably benign Het
Herc2 A G 7: 56,165,007 I2703V probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Iqcg G A 16: 33,050,008 silent Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lipo5 G T 19: 33,467,800 T123N unknown Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Map3k5 T A 10: 20,025,019 V313D probably damaging Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Olfr1110 C T 2: 87,135,814 C169Y probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rasal3 A T 17: 32,392,151 L912Q probably damaging Het
Reln C T 5: 21,948,566 V2247M probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Slc12a3 A G 8: 94,353,040 H832R probably benign Het
Slc27a2 A G 2: 126,567,798 D300G possibly damaging Het
Sos1 A G 17: 80,398,308 V1278A probably damaging Het
Sstr3 C A 15: 78,540,377 V57L probably damaging Het
Tex2 T A 11: 106,544,252 R783W unknown Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Top1 A T 2: 160,721,522 I758F probably damaging Het
Trim41 T C 11: 48,809,084 E98G possibly damaging Het
Vmn2r65 A T 7: 84,940,415 N764K probably damaging Het
Vmn2r81 A T 10: 79,270,600 I471F probably damaging Het
Wdr25 G A 12: 108,898,420 V164M probably damaging Het
Zdhhc13 T A 7: 48,802,944 L5M probably damaging Het
Other mutations in Pla2g5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03304:Pla2g5 APN 4 138804569 nonsense probably null
R0278:Pla2g5 UTSW 4 138800656 missense probably benign 0.40
R0323:Pla2g5 UTSW 4 138800656 missense probably benign 0.40
R0325:Pla2g5 UTSW 4 138800656 missense probably benign 0.40
R3767:Pla2g5 UTSW 4 138801435 missense probably damaging 1.00
R3768:Pla2g5 UTSW 4 138801435 missense probably damaging 1.00
R3769:Pla2g5 UTSW 4 138801435 missense probably damaging 1.00
R5620:Pla2g5 UTSW 4 138804610 missense possibly damaging 0.83
R6776:Pla2g5 UTSW 4 138800653 missense probably benign 0.00
R7065:Pla2g5 UTSW 4 138800604 missense probably damaging 1.00
R7097:Pla2g5 UTSW 4 138804519 missense probably damaging 1.00
R7122:Pla2g5 UTSW 4 138804519 missense probably damaging 1.00
R7829:Pla2g5 UTSW 4 138804534 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACTGAGTCTCAACTGGGACTTC -3'
(R):5'- AGCTTTAACATCCAAGCACAGTG -3'

Sequencing Primer
(F):5'- CCCTTTCCTGGAAGTCTAAAGAGG -3'
(R):5'- AGTGTCCCCAAGGTACCATTG -3'
Posted On2015-03-25