Mutagenetix > Incidental Mutation

Incidental Mutation 'R3770:Reln'

273208

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R3770 (G1)

Quality Score

181

Status

Not validated

Chromosome

Chromosomal Location

21884454-22344702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 21948566 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 2247 (V2247M)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000062372
AA Change: V2247M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: V2247M

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000084713

Predicted Effect

probably damaging
Transcript: ENSMUST00000161356
AA Change: V2247M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: V2247M

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162103

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	A	G	7: 127,384,863 (GRCm38)		probably benign	Het
Acox1	T	C	11: 116,174,387 (GRCm38)	D578G	probably damaging	Het
Adgrb1	T	A	15: 74,588,308 (GRCm38)	I543N	probably damaging	Het
Agbl1	T	C	7: 76,425,929 (GRCm38)		probably null	Het
Ano1	A	G	7: 144,595,569 (GRCm38)	Y852H	probably damaging	Het
Apol9a	G	C	15: 77,404,396 (GRCm38)	T257S	probably benign	Het
Arhgap23	A	T	11: 97,476,106 (GRCm38)	D1071V	probably damaging	Het
Atp1a1	T	C	3: 101,581,194 (GRCm38)	D842G	probably benign	Het
Brd7	A	T	8: 88,339,407 (GRCm38)		probably null	Het
Btbd7	G	A	12: 102,795,192 (GRCm38)	P578L	probably damaging	Het
C3	C	T	17: 57,205,303 (GRCm38)	D1542N	possibly damaging	Het
Cfap54	C	T	10: 92,878,536 (GRCm38)	M2660I	unknown	Het
Dock7	T	C	4: 98,970,829 (GRCm38)	T1409A	probably benign	Het
Exoc3l4	A	G	12: 111,425,555 (GRCm38)	D410G	probably benign	Het
Foxk2	CGGGGGG	CGGGGGGGGG	11: 121,260,491 (GRCm38)		probably benign	Het
Herc2	A	G	7: 56,165,007 (GRCm38)	I2703V	probably benign	Het
Ifna7	T	C	4: 88,816,727 (GRCm38)	V167A	probably damaging	Het
Iqcg	G	A	16: 33,050,008 (GRCm38)		silent	Het
Klf3	A	G	5: 64,827,217 (GRCm38)		probably null	Het
Krtap12-1	G	T	10: 77,720,895 (GRCm38)	V91L	probably benign	Het
Lipo5	G	T	19: 33,467,800 (GRCm38)	T123N	unknown	Het
Macf1	A	G	4: 123,374,767 (GRCm38)	S4689P	probably damaging	Het
Map3k5	T	A	10: 20,025,019 (GRCm38)	V313D	probably damaging	Het
Mypn	C	A	10: 63,125,707 (GRCm38)	L1035F	possibly damaging	Het
Neurl1a	T	C	19: 47,239,889 (GRCm38)	L58P	probably damaging	Het
Olfr1110	C	T	2: 87,135,814 (GRCm38)	C169Y	probably damaging	Het
Pla2g5	C	G	4: 138,801,435 (GRCm38)	C70S	probably damaging	Het
Pole4	G	A	6: 82,622,114 (GRCm38)	R119C	possibly damaging	Het
Ppm1h	G	T	10: 122,904,122 (GRCm38)	L367F	probably damaging	Het
Ptpru	C	T	4: 131,808,424 (GRCm38)	C414Y	probably damaging	Het
Rasal3	A	T	17: 32,392,151 (GRCm38)	L912Q	probably damaging	Het
Rhot2	T	C	17: 25,840,547 (GRCm38)	D407G	probably benign	Het
Rreb1	C	T	13: 37,929,603 (GRCm38)	R313W	possibly damaging	Het
Rufy4	T	C	1: 74,147,663 (GRCm38)	C537R	probably damaging	Het
Scn11a	T	A	9: 119,784,049 (GRCm38)	D825V	probably damaging	Het
Slc12a3	A	G	8: 94,353,040 (GRCm38)	H832R	probably benign	Het
Slc27a2	A	G	2: 126,567,798 (GRCm38)	D300G	possibly damaging	Het
Sos1	A	G	17: 80,398,308 (GRCm38)	V1278A	probably damaging	Het
Sstr3	C	A	15: 78,540,377 (GRCm38)	V57L	probably damaging	Het
Tex2	T	A	11: 106,544,252 (GRCm38)	R783W	unknown	Het
Tjp2	A	T	19: 24,100,826 (GRCm38)	I901N	probably benign	Het
Top1	A	T	2: 160,721,522 (GRCm38)	I758F	probably damaging	Het
Trim41	T	C	11: 48,809,084 (GRCm38)	E98G	possibly damaging	Het
Vmn2r65	A	T	7: 84,940,415 (GRCm38)	N764K	probably damaging	Het
Vmn2r81	A	T	10: 79,270,600 (GRCm38)	I471F	probably damaging	Het
Wdr25	G	A	12: 108,898,420 (GRCm38)	V164M	probably damaging	Het
Zdhhc13	T	A	7: 48,802,944 (GRCm38)	L5M	probably damaging	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22,010,127 (GRCm38)	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22,045,009 (GRCm38)	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22,154,950 (GRCm38)	missense	probably benign	0.01
IGL00755:Reln	APN	5	22,060,380 (GRCm38)	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22,018,850 (GRCm38)	critical splice donor site	probably null
IGL00900:Reln	APN	5	21,980,117 (GRCm38)	missense	probably damaging	0.98
IGL01067:Reln	APN	5	21,979,666 (GRCm38)	missense	probably damaging	1.00
IGL01104:Reln	APN	5	21,986,967 (GRCm38)	missense	probably damaging	0.99
IGL01141:Reln	APN	5	21,969,033 (GRCm38)	missense	probably damaging	1.00
IGL01141:Reln	APN	5	21,919,069 (GRCm38)	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22,171,251 (GRCm38)	missense	probably damaging	0.99
IGL01341:Reln	APN	5	21,969,079 (GRCm38)	missense	probably damaging	1.00
IGL01354:Reln	APN	5	21,919,175 (GRCm38)	nonsense	probably null
IGL01361:Reln	APN	5	21,919,021 (GRCm38)	missense	probably benign	0.06
IGL01446:Reln	APN	5	21,969,317 (GRCm38)	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22,040,405 (GRCm38)	missense	probably benign	0.40
IGL01612:Reln	APN	5	21,896,930 (GRCm38)	missense	probably damaging	0.99
IGL01695:Reln	APN	5	21,920,438 (GRCm38)	missense	probably damaging	1.00
IGL01718:Reln	APN	5	21,947,514 (GRCm38)	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22,344,246 (GRCm38)	nonsense	probably null
IGL01875:Reln	APN	5	21,904,717 (GRCm38)	missense	probably benign
IGL02013:Reln	APN	5	21,950,879 (GRCm38)	missense	probably damaging	1.00
IGL02031:Reln	APN	5	21,979,016 (GRCm38)	missense	probably damaging	0.99
IGL02186:Reln	APN	5	21,909,958 (GRCm38)	missense	probably damaging	1.00
IGL02228:Reln	APN	5	21,904,731 (GRCm38)	missense	probably damaging	0.99
IGL02248:Reln	APN	5	21,910,992 (GRCm38)	missense	probably damaging	1.00
IGL02336:Reln	APN	5	21,929,134 (GRCm38)	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22,080,791 (GRCm38)	nonsense	probably null
IGL02408:Reln	APN	5	21,901,619 (GRCm38)	missense	probably benign	0.44
IGL02415:Reln	APN	5	21,971,951 (GRCm38)	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22,040,427 (GRCm38)	missense	probably benign	0.00
IGL02540:Reln	APN	5	22,034,752 (GRCm38)	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22,103,357 (GRCm38)	missense	probably benign	0.09
IGL02720:Reln	APN	5	21,997,941 (GRCm38)	missense	probably damaging	0.99
IGL02894:Reln	APN	5	21,885,548 (GRCm38)	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	21,995,365 (GRCm38)	missense	probably damaging	1.00
IGL03125:Reln	APN	5	21,910,844 (GRCm38)	missense	probably damaging	1.00
IGL03298:Reln	APN	5	21,910,836 (GRCm38)	missense	probably damaging	0.99
Fishing	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22,106,060 (GRCm38)	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22,286,896 (GRCm38)	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	21,925,371 (GRCm38)	missense	probably benign	0.01
R0105:Reln	UTSW	5	22,048,815 (GRCm38)	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22,048,815 (GRCm38)	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22,004,136 (GRCm38)	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22,128,649 (GRCm38)	missense	probably damaging	0.99
R0144:Reln	UTSW	5	21,948,449 (GRCm38)	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22,106,045 (GRCm38)	missense	probably benign	0.36
R0240:Reln	UTSW	5	22,106,045 (GRCm38)	missense	probably benign	0.36
R0242:Reln	UTSW	5	21,942,597 (GRCm38)	critical splice donor site	probably null
R0242:Reln	UTSW	5	21,942,597 (GRCm38)	critical splice donor site	probably null
R0266:Reln	UTSW	5	21,988,776 (GRCm38)	missense	probably damaging	1.00
R0269:Reln	UTSW	5	21,920,537 (GRCm38)	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22,227,513 (GRCm38)	splice site	probably benign
R0333:Reln	UTSW	5	21,929,242 (GRCm38)	missense	probably damaging	0.97
R0357:Reln	UTSW	5	21,950,822 (GRCm38)	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22,048,800 (GRCm38)	missense	probably damaging	0.98
R0506:Reln	UTSW	5	21,920,496 (GRCm38)	missense	probably damaging	0.97
R0534:Reln	UTSW	5	21,947,408 (GRCm38)	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22,051,276 (GRCm38)	splice site	probably benign
R0541:Reln	UTSW	5	21,980,109 (GRCm38)	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22,010,150 (GRCm38)	missense	probably benign	0.36
R0617:Reln	UTSW	5	21,920,537 (GRCm38)	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22,018,869 (GRCm38)	missense	probably damaging	1.00
R0653:Reln	UTSW	5	21,913,230 (GRCm38)	missense	probably benign	0.44
R0704:Reln	UTSW	5	21,896,811 (GRCm38)	missense	probably damaging	0.99
R0706:Reln	UTSW	5	21,896,811 (GRCm38)	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22,227,628 (GRCm38)	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22,034,664 (GRCm38)	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22,034,775 (GRCm38)	missense	probably benign
R1163:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably benign	0.03
R1222:Reln	UTSW	5	21,986,955 (GRCm38)	missense	probably null	0.97
R1226:Reln	UTSW	5	21,910,866 (GRCm38)	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22,128,602 (GRCm38)	splice site	probably benign
R1532:Reln	UTSW	5	22,034,744 (GRCm38)	missense	probably damaging	0.99
R1552:Reln	UTSW	5	21,960,378 (GRCm38)	missense	probably benign	0.01
R1565:Reln	UTSW	5	21,925,213 (GRCm38)	missense	probably benign	0.05
R1618:Reln	UTSW	5	22,060,368 (GRCm38)	missense	probably benign	0.01
R1636:Reln	UTSW	5	21,998,683 (GRCm38)	missense	probably damaging	0.99
R1664:Reln	UTSW	5	21,929,086 (GRCm38)	missense	probably damaging	1.00
R1716:Reln	UTSW	5	21,955,095 (GRCm38)	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22,010,289 (GRCm38)	missense	probably damaging	0.99
R1835:Reln	UTSW	5	21,979,002 (GRCm38)	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22,044,962 (GRCm38)	critical splice donor site	probably null
R1991:Reln	UTSW	5	21,969,360 (GRCm38)	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	21,942,627 (GRCm38)	missense	probably benign	0.01
R2072:Reln	UTSW	5	21,919,177 (GRCm38)	missense	probably damaging	1.00
R2103:Reln	UTSW	5	21,969,360 (GRCm38)	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22,019,000 (GRCm38)	missense	probably damaging	1.00
R2120:Reln	UTSW	5	21,969,085 (GRCm38)	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22,048,005 (GRCm38)	missense	probably benign	0.30
R2219:Reln	UTSW	5	21,972,047 (GRCm38)	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	21,987,078 (GRCm38)	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	21,896,786 (GRCm38)	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22,154,956 (GRCm38)	missense	probably benign	0.00
R2321:Reln	UTSW	5	21,915,020 (GRCm38)	missense	probably damaging	0.99
R2512:Reln	UTSW	5	21,979,690 (GRCm38)	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22,344,369 (GRCm38)	missense	unknown
R2870:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22,040,420 (GRCm38)	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	21,995,589 (GRCm38)	splice site	probably benign
R3713:Reln	UTSW	5	21,904,734 (GRCm38)	missense	probably damaging	0.99
R3836:Reln	UTSW	5	21,911,014 (GRCm38)	missense	probably damaging	1.00
R3887:Reln	UTSW	5	21,910,849 (GRCm38)	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	21,979,001 (GRCm38)	missense	probably damaging	0.99
R3975:Reln	UTSW	5	21,995,366 (GRCm38)	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22,227,630 (GRCm38)	missense	probably benign	0.45
R4044:Reln	UTSW	5	22,128,632 (GRCm38)	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22,034,584 (GRCm38)	missense	probably damaging	1.00
R4297:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4298:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4299:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4518:Reln	UTSW	5	21,901,743 (GRCm38)	missense	probably benign	0.44
R4615:Reln	UTSW	5	21,972,872 (GRCm38)	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22,152,463 (GRCm38)	missense	probably benign	0.17
R4720:Reln	UTSW	5	22,286,896 (GRCm38)	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	21,919,222 (GRCm38)	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22,049,700 (GRCm38)	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22,344,185 (GRCm38)	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22,018,846 (GRCm38)	splice site	probably null
R4860:Reln	UTSW	5	21,901,751 (GRCm38)	missense	probably benign	0.06
R4860:Reln	UTSW	5	21,901,751 (GRCm38)	missense	probably benign	0.06
R4896:Reln	UTSW	5	21,955,238 (GRCm38)	missense	probably damaging	1.00
R4908:Reln	UTSW	5	21,979,720 (GRCm38)	missense	probably benign	0.02
R4912:Reln	UTSW	5	21,925,193 (GRCm38)	missense	probably benign	0.29
R4922:Reln	UTSW	5	21,995,587 (GRCm38)	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	21,960,426 (GRCm38)	missense	probably damaging	1.00
R4976:Reln	UTSW	5	21,971,870 (GRCm38)	missense	probably benign	0.05
R5020:Reln	UTSW	5	22,034,638 (GRCm38)	missense	probably damaging	1.00
R5037:Reln	UTSW	5	21,948,512 (GRCm38)	missense	probably damaging	1.00
R5082:Reln	UTSW	5	21,896,077 (GRCm38)	missense	probably benign	0.00
R5119:Reln	UTSW	5	21,971,870 (GRCm38)	missense	probably benign	0.05
R5125:Reln	UTSW	5	21,913,241 (GRCm38)	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	21,955,181 (GRCm38)	missense	probably damaging	1.00
R5152:Reln	UTSW	5	21,948,629 (GRCm38)	missense	probably damaging	1.00
R5154:Reln	UTSW	5	21,988,765 (GRCm38)	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22,103,397 (GRCm38)	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22,011,163 (GRCm38)	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22,039,529 (GRCm38)	missense	probably benign
R5400:Reln	UTSW	5	21,979,714 (GRCm38)	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22,004,203 (GRCm38)	missense	probably benign	0.00
R5514:Reln	UTSW	5	21,971,885 (GRCm38)	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	21,932,715 (GRCm38)	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22,039,665 (GRCm38)	nonsense	probably null
R5648:Reln	UTSW	5	21,998,572 (GRCm38)	missense	probably benign	0.04
R5649:Reln	UTSW	5	21,901,625 (GRCm38)	missense	probably benign	0.33
R5744:Reln	UTSW	5	22,106,083 (GRCm38)	missense	probably null	0.39
R5782:Reln	UTSW	5	22,018,056 (GRCm38)	missense	probably benign	0.01
R5815:Reln	UTSW	5	21,947,433 (GRCm38)	missense	probably damaging	0.99
R5838:Reln	UTSW	5	21,899,113 (GRCm38)	missense	probably damaging	0.97
R6162:Reln	UTSW	5	21,911,050 (GRCm38)	missense	probably damaging	1.00
R6219:Reln	UTSW	5	21,948,596 (GRCm38)	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22,060,333 (GRCm38)	missense	probably damaging	0.99
R6279:Reln	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22,286,944 (GRCm38)	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22,152,484 (GRCm38)	nonsense	probably null
R6351:Reln	UTSW	5	21,901,663 (GRCm38)	nonsense	probably null
R6369:Reln	UTSW	5	22,051,361 (GRCm38)	missense	probably benign	0.03
R6371:Reln	UTSW	5	21,995,513 (GRCm38)	missense	probably benign
R6374:Reln	UTSW	5	22,080,714 (GRCm38)	missense	probably benign	0.06
R6425:Reln	UTSW	5	21,911,020 (GRCm38)	nonsense	probably null
R6442:Reln	UTSW	5	21,932,776 (GRCm38)	missense	probably benign
R6445:Reln	UTSW	5	21,919,214 (GRCm38)	missense	probably benign	0.05
R6554:Reln	UTSW	5	21,896,840 (GRCm38)	missense	probably damaging	1.00
R6641:Reln	UTSW	5	21,929,134 (GRCm38)	missense	probably damaging	1.00
R6768:Reln	UTSW	5	21,978,907 (GRCm38)	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22,034,570 (GRCm38)	missense	probably damaging	1.00
R6896:Reln	UTSW	5	21,899,179 (GRCm38)	missense	probably benign	0.18
R6932:Reln	UTSW	5	21,985,857 (GRCm38)	missense	probably benign	0.00
R6948:Reln	UTSW	5	21,972,035 (GRCm38)	missense	probably damaging	1.00
R6959:Reln	UTSW	5	21,976,564 (GRCm38)	missense	probably damaging	1.00
R7085:Reln	UTSW	5	21,915,087 (GRCm38)	nonsense	probably null
R7091:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably null	0.08
R7135:Reln	UTSW	5	21,976,596 (GRCm38)	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22,106,097 (GRCm38)	missense	probably damaging	0.97
R7167:Reln	UTSW	5	21,942,620 (GRCm38)	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22,047,947 (GRCm38)	missense	probably damaging	1.00
R7256:Reln	UTSW	5	21,978,923 (GRCm38)	missense	probably benign	0.03
R7393:Reln	UTSW	5	21,976,351 (GRCm38)	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22,051,367 (GRCm38)	missense	probably damaging	0.99
R7400:Reln	UTSW	5	21,971,934 (GRCm38)	missense	probably damaging	0.99
R7426:Reln	UTSW	5	21,971,953 (GRCm38)	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22,103,435 (GRCm38)	missense	probably damaging	0.98
R7470:Reln	UTSW	5	21,942,741 (GRCm38)	missense	probably damaging	0.99
R7473:Reln	UTSW	5	21,929,127 (GRCm38)	missense	probably benign	0.25
R7501:Reln	UTSW	5	22,227,638 (GRCm38)	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	21,955,181 (GRCm38)	missense	probably damaging	1.00
R7544:Reln	UTSW	5	21,976,278 (GRCm38)	nonsense	probably null
R7588:Reln	UTSW	5	21,885,568 (GRCm38)	missense	probably benign	0.03
R7631:Reln	UTSW	5	21,971,935 (GRCm38)	missense	probably damaging	0.97
R7644:Reln	UTSW	5	21,978,931 (GRCm38)	missense	probably benign	0.39
R7834:Reln	UTSW	5	22,039,635 (GRCm38)	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22,134,692 (GRCm38)	missense	probably benign	0.00
R7938:Reln	UTSW	5	21,950,872 (GRCm38)	missense	probably damaging	0.97
R8006:Reln	UTSW	5	21,899,084 (GRCm38)	nonsense	probably null
R8062:Reln	UTSW	5	21,971,992 (GRCm38)	missense	probably benign	0.00
R8222:Reln	UTSW	5	21,931,477 (GRCm38)	nonsense	probably null
R8266:Reln	UTSW	5	22,018,087 (GRCm38)	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22,004,112 (GRCm38)	missense	probably damaging	1.00
R8487:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably benign	0.03
R8523:Reln	UTSW	5	22,004,231 (GRCm38)	missense	probably damaging	1.00
R8751:Reln	UTSW	5	21,942,674 (GRCm38)	missense	probably benign	0.37
R8801:Reln	UTSW	5	21,950,856 (GRCm38)	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	21,925,259 (GRCm38)	missense	probably damaging	0.98
R8978:Reln	UTSW	5	21,885,514 (GRCm38)	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	21,899,157 (GRCm38)	missense	probably damaging	0.97
R8995:Reln	UTSW	5	21,979,579 (GRCm38)	missense	probably benign	0.00
R9022:Reln	UTSW	5	21,976,615 (GRCm38)	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22,048,038 (GRCm38)	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22,011,061 (GRCm38)	missense	probably damaging	1.00
R9089:Reln	UTSW	5	21,925,200 (GRCm38)	missense	probably benign	0.01
R9126:Reln	UTSW	5	21,955,196 (GRCm38)	missense	probably damaging	1.00
R9172:Reln	UTSW	5	21,950,817 (GRCm38)	critical splice donor site	probably null
R9182:Reln	UTSW	5	21,901,619 (GRCm38)	missense	probably benign	0.44
R9196:Reln	UTSW	5	22,152,473 (GRCm38)	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22,344,202 (GRCm38)	nonsense	probably null
R9241:Reln	UTSW	5	21,969,069 (GRCm38)	missense	probably damaging	0.99
R9244:Reln	UTSW	5	21,915,153 (GRCm38)	missense	probably damaging	0.99
R9281:Reln	UTSW	5	21,948,547 (GRCm38)	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22,004,211 (GRCm38)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	21,988,707 (GRCm38)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,080,691 (GRCm38)	missense	probably benign	0.01
R9309:Reln	UTSW	5	21,971,868 (GRCm38)	missense	probably benign	0.37
R9338:Reln	UTSW	5	21,997,939 (GRCm38)	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22,344,204 (GRCm38)	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	21,915,107 (GRCm38)	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22,344,200 (GRCm38)	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	21,920,510 (GRCm38)	missense	possibly damaging	0.46
R9717:Reln	UTSW	5	21,931,429 (GRCm38)	missense	probably benign	0.26
R9745:Reln	UTSW	5	21,947,527 (GRCm38)	missense	probably damaging	1.00
R9778:Reln	UTSW	5	21,950,945 (GRCm38)	missense	probably damaging	1.00
Z1176:Reln	UTSW	5	21,979,024 (GRCm38)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,004,082 (GRCm38)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	21,969,241 (GRCm38)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,227,636 (GRCm38)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,154,959 (GRCm38)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AAGAGACTGACCTGGTCGATC -3'
(R):5'- TGGACACTCGTTAAATCGTCG -3'

Sequencing Primer
(F):5'- TCGATCACCCAGGGGCTATAG -3'
(R):5'- ATCGTCGTGTTTATTAACATCATCCG -3'

Posted On

2015-03-25