Incidental Mutation 'R3770:Zdhhc13'
ID273211
Institutional Source Beutler Lab
Gene Symbol Zdhhc13
Ensembl Gene ENSMUSG00000030471
Gene Namezinc finger, DHHC domain containing 13
Synonymskojak, Hip14l, skc4, 2410004E01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3770 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48789003-48827440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48802944 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 5 (L5M)
Ref Sequence ENSEMBL: ENSMUSP00000123603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118927] [ENSMUST00000125280]
Predicted Effect probably damaging
Transcript: ENSMUST00000118927
AA Change: L135M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112498
Gene: ENSMUSG00000030471
AA Change: L135M

DomainStartEndE-ValueType
Blast:ANK 48 77 1e-9 BLAST
ANK 81 110 3.08e-1 SMART
ANK 115 144 4.39e-6 SMART
ANK 148 177 2.37e-2 SMART
ANK 181 211 5.19e2 SMART
ANK 216 245 8.07e-5 SMART
ANK 249 277 1.09e3 SMART
transmembrane domain 292 310 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 344 366 N/A INTRINSIC
transmembrane domain 373 392 N/A INTRINSIC
Pfam:zf-DHHC 421 558 1.1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125280
AA Change: L5M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123603
Gene: ENSMUSG00000030471
AA Change: L5M

DomainStartEndE-ValueType
ANK 18 47 2.37e-2 SMART
ANK 51 81 5.19e2 SMART
ANK 86 115 8.07e-5 SMART
ANK 119 147 1.09e3 SMART
transmembrane domain 160 182 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Pfam:zf-DHHC 258 428 1.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207366
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation display wasting, weight loss, hair loss (alopecia), reduced bone mineral density (osteoporosis), and generalized amyloid deposition, which resulted in early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Acox1 T C 11: 116,174,387 D578G probably damaging Het
Adgrb1 T A 15: 74,588,308 I543N probably damaging Het
Agbl1 T C 7: 76,425,929 probably null Het
Ano1 A G 7: 144,595,569 Y852H probably damaging Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Atp1a1 T C 3: 101,581,194 D842G probably benign Het
Brd7 A T 8: 88,339,407 probably null Het
Btbd7 G A 12: 102,795,192 P578L probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cfap54 C T 10: 92,878,536 M2660I unknown Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exoc3l4 A G 12: 111,425,555 D410G probably benign Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,260,491 probably benign Het
Herc2 A G 7: 56,165,007 I2703V probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Iqcg G A 16: 33,050,008 silent Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lipo5 G T 19: 33,467,800 T123N unknown Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Map3k5 T A 10: 20,025,019 V313D probably damaging Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Olfr1110 C T 2: 87,135,814 C169Y probably damaging Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rasal3 A T 17: 32,392,151 L912Q probably damaging Het
Reln C T 5: 21,948,566 V2247M probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Slc12a3 A G 8: 94,353,040 H832R probably benign Het
Slc27a2 A G 2: 126,567,798 D300G possibly damaging Het
Sos1 A G 17: 80,398,308 V1278A probably damaging Het
Sstr3 C A 15: 78,540,377 V57L probably damaging Het
Tex2 T A 11: 106,544,252 R783W unknown Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Top1 A T 2: 160,721,522 I758F probably damaging Het
Trim41 T C 11: 48,809,084 E98G possibly damaging Het
Vmn2r65 A T 7: 84,940,415 N764K probably damaging Het
Vmn2r81 A T 10: 79,270,600 I471F probably damaging Het
Wdr25 G A 12: 108,898,420 V164M probably damaging Het
Other mutations in Zdhhc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Zdhhc13 APN 7 48805601 missense probably benign 0.00
IGL01820:Zdhhc13 APN 7 48808865 missense probably damaging 1.00
IGL02941:Zdhhc13 APN 7 48817138 splice site probably benign
bernard UTSW 7 48826873 missense probably damaging 1.00
brindle UTSW 7 48824731 missense possibly damaging 0.47
oxidized UTSW 7 48816427 missense probably benign 0.04
rusty UTSW 7 48824644 missense possibly damaging 0.95
PIT4445001:Zdhhc13 UTSW 7 48795949 missense probably benign 0.00
R0456:Zdhhc13 UTSW 7 48808854 missense probably benign 0.03
R1398:Zdhhc13 UTSW 7 48826873 missense probably damaging 1.00
R1785:Zdhhc13 UTSW 7 48824644 missense possibly damaging 0.95
R1786:Zdhhc13 UTSW 7 48824644 missense possibly damaging 0.95
R2066:Zdhhc13 UTSW 7 48816427 missense probably benign 0.04
R2131:Zdhhc13 UTSW 7 48824644 missense possibly damaging 0.95
R2133:Zdhhc13 UTSW 7 48824644 missense possibly damaging 0.95
R2405:Zdhhc13 UTSW 7 48822730 splice site probably null
R4374:Zdhhc13 UTSW 7 48808841 missense probably damaging 1.00
R4772:Zdhhc13 UTSW 7 48799873 missense probably benign 0.24
R5052:Zdhhc13 UTSW 7 48824731 missense possibly damaging 0.47
R5455:Zdhhc13 UTSW 7 48805575 missense possibly damaging 0.95
R6418:Zdhhc13 UTSW 7 48811401 missense possibly damaging 0.94
R6502:Zdhhc13 UTSW 7 48815560 missense possibly damaging 0.95
R7136:Zdhhc13 UTSW 7 48801332 missense probably benign
R7467:Zdhhc13 UTSW 7 48804408 missense probably benign 0.02
R7485:Zdhhc13 UTSW 7 48811355 nonsense probably null
R7723:Zdhhc13 UTSW 7 48808819 missense probably benign
X0021:Zdhhc13 UTSW 7 48805215 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GAGTAGAAGTTACTTGTACAACGTC -3'
(R):5'- CAATTTAAAACTGACGGTAGACCAG -3'

Sequencing Primer
(F):5'- AGTTACTTGTACAACGTCAAGTTAC -3'
(R):5'- GGTAGACCAGGGCCAATAACC -3'
Posted On2015-03-25