Mutagenetix > Incidental Mutations

Incidental Mutation 'R3770:Ano1'

273216

Institutional Source

Beutler Lab

Gene Symbol

Ano1

Ensembl Gene

ENSMUSG00000031075

Gene Name

anoctamin 1, calcium activated chloride channel

Synonyms

Tmem16a

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3770 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

144588549-144751974 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 144595569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 852 (Y852H)

Ref Sequence

ENSEMBL: ENSMUSP00000112616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033393] [ENSMUST00000118556] [ENSMUST00000121758]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000033393
AA Change: Y791H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033393
Gene: ENSMUSG00000031075
AA Change: Y791H

Domain	Start	End	E-Value	Type
low complexity region	129	147	N/A	INTRINSIC
Pfam:Anoctamin	320	898	1.3e-149	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000118556
AA Change: Y849H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113899
Gene: ENSMUSG00000031075
AA Change: Y849H

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	112	375	5.5e-83	PFAM
Pfam:Anoctamin	378	955	6.7e-140	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121758
AA Change: Y852H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112616
Gene: ENSMUSG00000031075
AA Change: Y852H

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	54	317	7.1e-83	PFAM
Pfam:Anoctamin	320	901	2.2e-139	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131571

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele exhibit postnatal death associated with aerophagia, slow postnatal weight gain, cyanosis, and abnormal tracheal morphology. Mice homozygous for a different knock-out allele exhibit proteinuria and intracellular endosomal vesicles in PTE cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	A	G	7: 127,384,863		probably benign	Het
Acox1	T	C	11: 116,174,387	D578G	probably damaging	Het
Adgrb1	T	A	15: 74,588,308	I543N	probably damaging	Het
Agbl1	T	C	7: 76,425,929		probably null	Het
Apol9a	G	C	15: 77,404,396	T257S	probably benign	Het
Arhgap23	A	T	11: 97,476,106	D1071V	probably damaging	Het
Atp1a1	T	C	3: 101,581,194	D842G	probably benign	Het
Brd7	A	T	8: 88,339,407		probably null	Het
Btbd7	G	A	12: 102,795,192	P578L	probably damaging	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cfap54	C	T	10: 92,878,536	M2660I	unknown	Het
Dock7	T	C	4: 98,970,829	T1409A	probably benign	Het
Exoc3l4	A	G	12: 111,425,555	D410G	probably benign	Het
Foxk2	CGGGGGG	CGGGGGGGGG	11: 121,260,491		probably benign	Het
Herc2	A	G	7: 56,165,007	I2703V	probably benign	Het
Ifna7	T	C	4: 88,816,727	V167A	probably damaging	Het
Iqcg	G	A	16: 33,050,008		silent	Het
Klf3	A	G	5: 64,827,217		probably null	Het
Krtap12-1	G	T	10: 77,720,895	V91L	probably benign	Het
Lipo5	G	T	19: 33,467,800	T123N	unknown	Het
Macf1	A	G	4: 123,374,767	S4689P	probably damaging	Het
Map3k5	T	A	10: 20,025,019	V313D	probably damaging	Het
Mypn	C	A	10: 63,125,707	L1035F	possibly damaging	Het
Neurl1a	T	C	19: 47,239,889	L58P	probably damaging	Het
Olfr1110	C	T	2: 87,135,814	C169Y	probably damaging	Het
Pla2g5	C	G	4: 138,801,435	C70S	probably damaging	Het
Pole4	G	A	6: 82,622,114	R119C	possibly damaging	Het
Ppm1h	G	T	10: 122,904,122	L367F	probably damaging	Het
Ptpru	C	T	4: 131,808,424	C414Y	probably damaging	Het
Rasal3	A	T	17: 32,392,151	L912Q	probably damaging	Het
Reln	C	T	5: 21,948,566	V2247M	probably damaging	Het
Rhot2	T	C	17: 25,840,547	D407G	probably benign	Het
Rreb1	C	T	13: 37,929,603	R313W	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Scn11a	T	A	9: 119,784,049	D825V	probably damaging	Het
Slc12a3	A	G	8: 94,353,040	H832R	probably benign	Het
Slc27a2	A	G	2: 126,567,798	D300G	possibly damaging	Het
Sos1	A	G	17: 80,398,308	V1278A	probably damaging	Het
Sstr3	C	A	15: 78,540,377	V57L	probably damaging	Het
Tex2	T	A	11: 106,544,252	R783W	unknown	Het
Tjp2	A	T	19: 24,100,826	I901N	probably benign	Het
Top1	A	T	2: 160,721,522	I758F	probably damaging	Het
Trim41	T	C	11: 48,809,084	E98G	possibly damaging	Het
Vmn2r65	A	T	7: 84,940,415	N764K	probably damaging	Het
Vmn2r81	A	T	10: 79,270,600	I471F	probably damaging	Het
Wdr25	G	A	12: 108,898,420	V164M	probably damaging	Het
Zdhhc13	T	A	7: 48,802,944	L5M	probably damaging	Het

Other mutations in Ano1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Ano1	APN	7	144638513	missense	probably damaging	1.00
IGL00754:Ano1	APN	7	144597231	missense	probably damaging	0.98
IGL00780:Ano1	APN	7	144655630	missense	probably damaging	0.99
IGL00918:Ano1	APN	7	144644752	splice site	probably benign
IGL01112:Ano1	APN	7	144637145	missense	possibly damaging	0.52
IGL01285:Ano1	APN	7	144644742	missense	probably benign	0.00
IGL01285:Ano1	APN	7	144595538	missense	probably damaging	0.98
IGL01308:Ano1	APN	7	144595498	missense	probably damaging	0.99
IGL01407:Ano1	APN	7	144637111	missense	probably benign	0.22
IGL01672:Ano1	APN	7	144655675	missense	probably damaging	0.96
IGL01920:Ano1	APN	7	144611454	splice site	probably benign
IGL01926:Ano1	APN	7	144610875	missense	possibly damaging	0.94
IGL02164:Ano1	APN	7	144637181	missense	possibly damaging	0.91
IGL02190:Ano1	APN	7	144618883	missense	probably benign	0.41
IGL02214:Ano1	APN	7	144655708	missense	possibly damaging	0.80
IGL02299:Ano1	APN	7	144590075	missense	possibly damaging	0.80
IGL02567:Ano1	APN	7	144611625	missense	probably damaging	1.00
IGL03131:Ano1	APN	7	144603585	missense	possibly damaging	0.90
IGL03291:Ano1	APN	7	144621675	missense	probably damaging	1.00
IGL03299:Ano1	APN	7	144654256	missense	probably damaging	1.00
IGL03394:Ano1	APN	7	144595439	splice site	probably null
PIT4434001:Ano1	UTSW	7	144610895	missense	probably benign	0.28
R0502:Ano1	UTSW	7	144597215	missense	probably damaging	1.00
R0595:Ano1	UTSW	7	144590153	missense	possibly damaging	0.94
R0732:Ano1	UTSW	7	144619488	critical splice acceptor site	probably null
R0970:Ano1	UTSW	7	144595571	missense	probably benign	0.02
R0988:Ano1	UTSW	7	144633653	missense	possibly damaging	0.94
R1074:Ano1	UTSW	7	144611680	missense	probably damaging	0.98
R1301:Ano1	UTSW	7	144633689	missense	possibly damaging	0.60
R1528:Ano1	UTSW	7	144595566	missense	probably damaging	1.00
R2018:Ano1	UTSW	7	144654250	missense	probably damaging	1.00
R2056:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2057:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2058:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2059:Ano1	UTSW	7	144611390	missense	probably damaging	1.00
R2860:Ano1	UTSW	7	144590012	missense	probably damaging	1.00
R2861:Ano1	UTSW	7	144590012	missense	probably damaging	1.00
R3970:Ano1	UTSW	7	144607963	missense	probably benign	0.00
R4179:Ano1	UTSW	7	144650505	missense	probably damaging	1.00
R4489:Ano1	UTSW	7	144611742	missense	probably benign	0.00
R4678:Ano1	UTSW	7	144669552	missense	probably benign	0.01
R4915:Ano1	UTSW	7	144611375	missense	possibly damaging	0.69
R5114:Ano1	UTSW	7	144657083	missense	possibly damaging	0.71
R5362:Ano1	UTSW	7	144648600	unclassified	probably benign
R5364:Ano1	UTSW	7	144637204	missense	probably damaging	1.00
R5366:Ano1	UTSW	7	144654209	missense	possibly damaging	0.85
R5387:Ano1	UTSW	7	144648619	missense	probably benign
R5762:Ano1	UTSW	7	144648037	missense	probably damaging	0.99
R5857:Ano1	UTSW	7	144637103	missense	probably benign	0.02
R6091:Ano1	UTSW	7	144669434	missense	probably benign	0.12
R6093:Ano1	UTSW	7	144611377	missense	possibly damaging	0.72
R6177:Ano1	UTSW	7	144678741	missense	possibly damaging	0.79
R6246:Ano1	UTSW	7	144633725	missense	possibly damaging	0.82
R6274:Ano1	UTSW	7	144618863	missense	probably benign	0.01
R6323:Ano1	UTSW	7	144611686	missense	possibly damaging	0.95
R6574:Ano1	UTSW	7	144607916	critical splice donor site	probably null
R6782:Ano1	UTSW	7	144621687	missense	probably damaging	1.00
R6880:Ano1	UTSW	7	144644742	missense	probably benign	0.00
R6909:Ano1	UTSW	7	144655731	missense	probably damaging	0.96
R7066:Ano1	UTSW	7	144637086	missense	probably benign	0.35
R7073:Ano1	UTSW	7	144638552	missense	probably damaging	0.96
R7146:Ano1	UTSW	7	144655656	missense	probably benign	0.00
R7420:Ano1	UTSW	7	144655641	missense	probably benign	0.00
R7874:Ano1	UTSW	7	144621724	missense	probably damaging	1.00
R8468:Ano1	UTSW	7	144655620	missense	probably damaging	1.00
R8867:Ano1	UTSW	7	144669660	missense	possibly damaging	0.66
R8923:Ano1	UTSW	7	144650551	missense	possibly damaging	0.61
R9215:Ano1	UTSW	7	144595605	missense	probably damaging	1.00
R9281:Ano1	UTSW	7	144595581	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATTACTCATTGAGTCCTGCC -3'
(R):5'- ACAATCAGGCTCCTGCAAG -3'

Sequencing Primer
(F):5'- ATTGAGTCCTGCCCCCGAAG -3'
(R):5'- GCAAGCTGCAGAGTAGAGC -3'

Posted On

2015-03-25