Incidental Mutation 'R3770:Ano1'
ID 273216
Institutional Source Beutler Lab
Gene Symbol Ano1
Ensembl Gene ENSMUSG00000031075
Gene Name anoctamin 1, calcium activated chloride channel
Synonyms Tmem16a
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3770 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 144588549-144751974 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144595569 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 852 (Y852H)
Ref Sequence ENSEMBL: ENSMUSP00000112616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033393] [ENSMUST00000118556] [ENSMUST00000121758]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033393
AA Change: Y791H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033393
Gene: ENSMUSG00000031075
AA Change: Y791H

DomainStartEndE-ValueType
low complexity region 129 147 N/A INTRINSIC
Pfam:Anoctamin 320 898 1.3e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118556
AA Change: Y849H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113899
Gene: ENSMUSG00000031075
AA Change: Y849H

DomainStartEndE-ValueType
Pfam:Anoct_dimer 112 375 5.5e-83 PFAM
Pfam:Anoctamin 378 955 6.7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121758
AA Change: Y852H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112616
Gene: ENSMUSG00000031075
AA Change: Y852H

DomainStartEndE-ValueType
Pfam:Anoct_dimer 54 317 7.1e-83 PFAM
Pfam:Anoctamin 320 901 2.2e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131571
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit postnatal death associated with aerophagia, slow postnatal weight gain, cyanosis, and abnormal tracheal morphology. Mice homozygous for a different knock-out allele exhibit proteinuria and intracellular endosomal vesicles in PTE cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Acox1 T C 11: 116,174,387 D578G probably damaging Het
Adgrb1 T A 15: 74,588,308 I543N probably damaging Het
Agbl1 T C 7: 76,425,929 probably null Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Atp1a1 T C 3: 101,581,194 D842G probably benign Het
Brd7 A T 8: 88,339,407 probably null Het
Btbd7 G A 12: 102,795,192 P578L probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cfap54 C T 10: 92,878,536 M2660I unknown Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exoc3l4 A G 12: 111,425,555 D410G probably benign Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,260,491 probably benign Het
Herc2 A G 7: 56,165,007 I2703V probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Iqcg G A 16: 33,050,008 silent Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lipo5 G T 19: 33,467,800 T123N unknown Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Map3k5 T A 10: 20,025,019 V313D probably damaging Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Olfr1110 C T 2: 87,135,814 C169Y probably damaging Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rasal3 A T 17: 32,392,151 L912Q probably damaging Het
Reln C T 5: 21,948,566 V2247M probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Slc12a3 A G 8: 94,353,040 H832R probably benign Het
Slc27a2 A G 2: 126,567,798 D300G possibly damaging Het
Sos1 A G 17: 80,398,308 V1278A probably damaging Het
Sstr3 C A 15: 78,540,377 V57L probably damaging Het
Tex2 T A 11: 106,544,252 R783W unknown Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Top1 A T 2: 160,721,522 I758F probably damaging Het
Trim41 T C 11: 48,809,084 E98G possibly damaging Het
Vmn2r65 A T 7: 84,940,415 N764K probably damaging Het
Vmn2r81 A T 10: 79,270,600 I471F probably damaging Het
Wdr25 G A 12: 108,898,420 V164M probably damaging Het
Zdhhc13 T A 7: 48,802,944 L5M probably damaging Het
Other mutations in Ano1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Ano1 APN 7 144638513 missense probably damaging 1.00
IGL00754:Ano1 APN 7 144597231 missense probably damaging 0.98
IGL00780:Ano1 APN 7 144655630 missense probably damaging 0.99
IGL00918:Ano1 APN 7 144644752 splice site probably benign
IGL01112:Ano1 APN 7 144637145 missense possibly damaging 0.52
IGL01285:Ano1 APN 7 144644742 missense probably benign 0.00
IGL01285:Ano1 APN 7 144595538 missense probably damaging 0.98
IGL01308:Ano1 APN 7 144595498 missense probably damaging 0.99
IGL01407:Ano1 APN 7 144637111 missense probably benign 0.22
IGL01672:Ano1 APN 7 144655675 missense probably damaging 0.96
IGL01920:Ano1 APN 7 144611454 splice site probably benign
IGL01926:Ano1 APN 7 144610875 missense possibly damaging 0.94
IGL02164:Ano1 APN 7 144637181 missense possibly damaging 0.91
IGL02190:Ano1 APN 7 144618883 missense probably benign 0.41
IGL02214:Ano1 APN 7 144655708 missense possibly damaging 0.80
IGL02299:Ano1 APN 7 144590075 missense possibly damaging 0.80
IGL02567:Ano1 APN 7 144611625 missense probably damaging 1.00
IGL03131:Ano1 APN 7 144603585 missense possibly damaging 0.90
IGL03291:Ano1 APN 7 144621675 missense probably damaging 1.00
IGL03299:Ano1 APN 7 144654256 missense probably damaging 1.00
IGL03394:Ano1 APN 7 144595439 splice site probably null
PIT4434001:Ano1 UTSW 7 144610895 missense probably benign 0.28
R0502:Ano1 UTSW 7 144597215 missense probably damaging 1.00
R0595:Ano1 UTSW 7 144590153 missense possibly damaging 0.94
R0732:Ano1 UTSW 7 144619488 critical splice acceptor site probably null
R0970:Ano1 UTSW 7 144595571 missense probably benign 0.02
R0988:Ano1 UTSW 7 144633653 missense possibly damaging 0.94
R1074:Ano1 UTSW 7 144611680 missense probably damaging 0.98
R1301:Ano1 UTSW 7 144633689 missense possibly damaging 0.60
R1528:Ano1 UTSW 7 144595566 missense probably damaging 1.00
R2018:Ano1 UTSW 7 144654250 missense probably damaging 1.00
R2056:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2057:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2058:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2059:Ano1 UTSW 7 144611390 missense probably damaging 1.00
R2860:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R2861:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R3970:Ano1 UTSW 7 144607963 missense probably benign 0.00
R4179:Ano1 UTSW 7 144650505 missense probably damaging 1.00
R4489:Ano1 UTSW 7 144611742 missense probably benign 0.00
R4678:Ano1 UTSW 7 144669552 missense probably benign 0.01
R4915:Ano1 UTSW 7 144611375 missense possibly damaging 0.69
R5114:Ano1 UTSW 7 144657083 missense possibly damaging 0.71
R5362:Ano1 UTSW 7 144648600 unclassified probably benign
R5364:Ano1 UTSW 7 144637204 missense probably damaging 1.00
R5366:Ano1 UTSW 7 144654209 missense possibly damaging 0.85
R5387:Ano1 UTSW 7 144648619 missense probably benign
R5762:Ano1 UTSW 7 144648037 missense probably damaging 0.99
R5857:Ano1 UTSW 7 144637103 missense probably benign 0.02
R6091:Ano1 UTSW 7 144669434 missense probably benign 0.12
R6093:Ano1 UTSW 7 144611377 missense possibly damaging 0.72
R6177:Ano1 UTSW 7 144678741 missense possibly damaging 0.79
R6246:Ano1 UTSW 7 144633725 missense possibly damaging 0.82
R6274:Ano1 UTSW 7 144618863 missense probably benign 0.01
R6323:Ano1 UTSW 7 144611686 missense possibly damaging 0.95
R6574:Ano1 UTSW 7 144607916 critical splice donor site probably null
R6782:Ano1 UTSW 7 144621687 missense probably damaging 1.00
R6880:Ano1 UTSW 7 144644742 missense probably benign 0.00
R6909:Ano1 UTSW 7 144655731 missense probably damaging 0.96
R7066:Ano1 UTSW 7 144637086 missense probably benign 0.35
R7073:Ano1 UTSW 7 144638552 missense probably damaging 0.96
R7146:Ano1 UTSW 7 144655656 missense probably benign 0.00
R7420:Ano1 UTSW 7 144655641 missense probably benign 0.00
R7874:Ano1 UTSW 7 144621724 missense probably damaging 1.00
R8468:Ano1 UTSW 7 144655620 missense probably damaging 1.00
R8867:Ano1 UTSW 7 144669660 missense possibly damaging 0.66
R8923:Ano1 UTSW 7 144650551 missense possibly damaging 0.61
R9215:Ano1 UTSW 7 144595605 missense probably damaging 1.00
R9281:Ano1 UTSW 7 144595581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTACTCATTGAGTCCTGCC -3'
(R):5'- ACAATCAGGCTCCTGCAAG -3'

Sequencing Primer
(F):5'- ATTGAGTCCTGCCCCCGAAG -3'
(R):5'- GCAAGCTGCAGAGTAGAGC -3'
Posted On 2015-03-25