Incidental Mutation 'R3770:Ppm1h'
ID273225
Institutional Source Beutler Lab
Gene Symbol Ppm1h
Ensembl Gene ENSMUSG00000034613
Gene Nameprotein phosphatase 1H (PP2C domain containing)
SynonymsARHCL1, A430075L18Rik, C030002B11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R3770 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location122678762-122945795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122904122 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 367 (L367F)
Ref Sequence ENSEMBL: ENSMUSP00000124982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067918] [ENSMUST00000161487] [ENSMUST00000162969]
Predicted Effect probably damaging
Transcript: ENSMUST00000067918
AA Change: L367F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066561
Gene: ENSMUSG00000034613
AA Change: L367F

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
PP2Cc 67 504 1.22e-35 SMART
PP2C_SIG 136 506 1.59e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161065
Predicted Effect probably damaging
Transcript: ENSMUST00000161487
AA Change: L367F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124982
Gene: ENSMUSG00000034613
AA Change: L367F

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
PP2Cc 67 455 6.36e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162969
SMART Domains Protein: ENSMUSP00000124006
Gene: ENSMUSG00000034613

DomainStartEndE-ValueType
Pfam:PP2C 2 99 2.9e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Acox1 T C 11: 116,174,387 D578G probably damaging Het
Adgrb1 T A 15: 74,588,308 I543N probably damaging Het
Agbl1 T C 7: 76,425,929 probably null Het
Ano1 A G 7: 144,595,569 Y852H probably damaging Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Atp1a1 T C 3: 101,581,194 D842G probably benign Het
Brd7 A T 8: 88,339,407 probably null Het
Btbd7 G A 12: 102,795,192 P578L probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cfap54 C T 10: 92,878,536 M2660I unknown Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exoc3l4 A G 12: 111,425,555 D410G probably benign Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,260,491 probably benign Het
Herc2 A G 7: 56,165,007 I2703V probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Iqcg G A 16: 33,050,008 silent Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lipo5 G T 19: 33,467,800 T123N unknown Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Map3k5 T A 10: 20,025,019 V313D probably damaging Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Olfr1110 C T 2: 87,135,814 C169Y probably damaging Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rasal3 A T 17: 32,392,151 L912Q probably damaging Het
Reln C T 5: 21,948,566 V2247M probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Slc12a3 A G 8: 94,353,040 H832R probably benign Het
Slc27a2 A G 2: 126,567,798 D300G possibly damaging Het
Sos1 A G 17: 80,398,308 V1278A probably damaging Het
Sstr3 C A 15: 78,540,377 V57L probably damaging Het
Tex2 T A 11: 106,544,252 R783W unknown Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Top1 A T 2: 160,721,522 I758F probably damaging Het
Trim41 T C 11: 48,809,084 E98G possibly damaging Het
Vmn2r65 A T 7: 84,940,415 N764K probably damaging Het
Vmn2r81 A T 10: 79,270,600 I471F probably damaging Het
Wdr25 G A 12: 108,898,420 V164M probably damaging Het
Zdhhc13 T A 7: 48,802,944 L5M probably damaging Het
Other mutations in Ppm1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Ppm1h APN 10 122878629 critical splice donor site probably null
IGL01060:Ppm1h APN 10 122907571 missense possibly damaging 0.49
IGL01557:Ppm1h APN 10 122782181 critical splice acceptor site probably null
IGL01608:Ppm1h APN 10 122941280 nonsense probably null
IGL02112:Ppm1h APN 10 122802400 missense possibly damaging 0.86
R0129:Ppm1h UTSW 10 122941355 missense probably damaging 0.97
R0217:Ppm1h UTSW 10 122920735 missense probably damaging 1.00
R0309:Ppm1h UTSW 10 122920782 missense probably damaging 1.00
R0455:Ppm1h UTSW 10 122802324 missense probably benign 0.00
R1144:Ppm1h UTSW 10 122941278 missense probably benign 0.01
R1430:Ppm1h UTSW 10 122857099 missense probably damaging 1.00
R2014:Ppm1h UTSW 10 122920725 missense possibly damaging 0.79
R2021:Ppm1h UTSW 10 122878528 nonsense probably null
R2882:Ppm1h UTSW 10 122941334 missense probably damaging 0.99
R3767:Ppm1h UTSW 10 122904122 missense probably damaging 1.00
R3768:Ppm1h UTSW 10 122904122 missense probably damaging 1.00
R4816:Ppm1h UTSW 10 122679379 missense possibly damaging 0.89
R4996:Ppm1h UTSW 10 122941340 missense probably damaging 1.00
R5640:Ppm1h UTSW 10 122782278 missense probably benign 0.30
R6199:Ppm1h UTSW 10 122920739 missense probably damaging 1.00
R7759:Ppm1h UTSW 10 122904113 missense probably benign
R8160:Ppm1h UTSW 10 122802436 missense probably benign 0.01
R8300:Ppm1h UTSW 10 122782213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACATTTCCTGGCTTGTCATTG -3'
(R):5'- ATGTTTGTTCAAGTTGTCAAGGCC -3'

Sequencing Primer
(F):5'- ACACACAATTTTGCATGGAGC -3'
(R):5'- GTTCAAGTTGTCAAGGCCATAAAACC -3'
Posted On2015-03-25