Incidental Mutation 'R3770:Exoc3l4'
ID273236
Institutional Source Beutler Lab
Gene Symbol Exoc3l4
Ensembl Gene ENSMUSG00000021280
Gene Nameexocyst complex component 3-like 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R3770 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location111417017-111431678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111425555 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 410 (D410G)
Ref Sequence ENSEMBL: ENSMUSP00000152337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072646] [ENSMUST00000220537] [ENSMUST00000220852] [ENSMUST00000221144] [ENSMUST00000222437] [ENSMUST00000222897] [ENSMUST00000223050] [ENSMUST00000223431]
Predicted Effect probably benign
Transcript: ENSMUST00000072646
AA Change: D410G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072438
Gene: ENSMUSG00000021280
AA Change: D410G

DomainStartEndE-ValueType
low complexity region 75 89 N/A INTRINSIC
Pfam:Sec6 181 708 7.1e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181085
Predicted Effect probably benign
Transcript: ENSMUST00000220537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220636
Predicted Effect probably benign
Transcript: ENSMUST00000220852
Predicted Effect probably benign
Transcript: ENSMUST00000221144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222262
Predicted Effect probably benign
Transcript: ENSMUST00000222437
Predicted Effect probably benign
Transcript: ENSMUST00000222897
AA Change: D410G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223050
AA Change: D410G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223369
Predicted Effect probably benign
Transcript: ENSMUST00000223431
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Acox1 T C 11: 116,174,387 D578G probably damaging Het
Adgrb1 T A 15: 74,588,308 I543N probably damaging Het
Agbl1 T C 7: 76,425,929 probably null Het
Ano1 A G 7: 144,595,569 Y852H probably damaging Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Atp1a1 T C 3: 101,581,194 D842G probably benign Het
Brd7 A T 8: 88,339,407 probably null Het
Btbd7 G A 12: 102,795,192 P578L probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cfap54 C T 10: 92,878,536 M2660I unknown Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,260,491 probably benign Het
Herc2 A G 7: 56,165,007 I2703V probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Iqcg G A 16: 33,050,008 silent Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lipo5 G T 19: 33,467,800 T123N unknown Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Map3k5 T A 10: 20,025,019 V313D probably damaging Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Olfr1110 C T 2: 87,135,814 C169Y probably damaging Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rasal3 A T 17: 32,392,151 L912Q probably damaging Het
Reln C T 5: 21,948,566 V2247M probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Slc12a3 A G 8: 94,353,040 H832R probably benign Het
Slc27a2 A G 2: 126,567,798 D300G possibly damaging Het
Sos1 A G 17: 80,398,308 V1278A probably damaging Het
Sstr3 C A 15: 78,540,377 V57L probably damaging Het
Tex2 T A 11: 106,544,252 R783W unknown Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Top1 A T 2: 160,721,522 I758F probably damaging Het
Trim41 T C 11: 48,809,084 E98G possibly damaging Het
Vmn2r65 A T 7: 84,940,415 N764K probably damaging Het
Vmn2r81 A T 10: 79,270,600 I471F probably damaging Het
Wdr25 G A 12: 108,898,420 V164M probably damaging Het
Zdhhc13 T A 7: 48,802,944 L5M probably damaging Het
Other mutations in Exoc3l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Exoc3l4 APN 12 111429411 splice site probably benign
IGL02048:Exoc3l4 APN 12 111428483 missense probably benign 0.00
IGL03049:Exoc3l4 APN 12 111423401 missense probably damaging 0.96
IGL03069:Exoc3l4 APN 12 111424023 missense probably damaging 1.00
IGL03123:Exoc3l4 APN 12 111422113 missense probably damaging 1.00
R0631:Exoc3l4 UTSW 12 111427966 missense probably benign 0.34
R1377:Exoc3l4 UTSW 12 111428670 missense probably damaging 1.00
R2223:Exoc3l4 UTSW 12 111426152 missense possibly damaging 0.73
R2402:Exoc3l4 UTSW 12 111422256 missense possibly damaging 0.94
R2884:Exoc3l4 UTSW 12 111428522 missense possibly damaging 0.93
R4843:Exoc3l4 UTSW 12 111428053 intron probably benign
R4903:Exoc3l4 UTSW 12 111428721 missense probably benign 0.00
R4964:Exoc3l4 UTSW 12 111428721 missense probably benign 0.00
R4966:Exoc3l4 UTSW 12 111428721 missense probably benign 0.00
R5082:Exoc3l4 UTSW 12 111427990 missense probably benign 0.04
R5152:Exoc3l4 UTSW 12 111430893 utr 3 prime probably benign
R5210:Exoc3l4 UTSW 12 111428841 intron probably benign
R5667:Exoc3l4 UTSW 12 111423417 missense probably damaging 1.00
R5671:Exoc3l4 UTSW 12 111423417 missense probably damaging 1.00
R5712:Exoc3l4 UTSW 12 111424042 nonsense probably null
R5873:Exoc3l4 UTSW 12 111423416 missense probably damaging 1.00
R5947:Exoc3l4 UTSW 12 111422401 missense possibly damaging 0.94
R6299:Exoc3l4 UTSW 12 111422079 start codon destroyed possibly damaging 0.59
R6332:Exoc3l4 UTSW 12 111427968 missense possibly damaging 0.79
R6489:Exoc3l4 UTSW 12 111428697 missense probably damaging 1.00
R7225:Exoc3l4 UTSW 12 111423624 missense probably benign 0.10
R7643:Exoc3l4 UTSW 12 111421935 intron probably benign
R7731:Exoc3l4 UTSW 12 111430748 missense possibly damaging 0.94
R7791:Exoc3l4 UTSW 12 111423540 missense probably damaging 1.00
Z1088:Exoc3l4 UTSW 12 111429487 missense probably benign 0.29
Z1176:Exoc3l4 UTSW 12 111423720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAAGCGATGGACCATGAC -3'
(R):5'- AGAGCTGTGATTTAACCTGGC -3'

Sequencing Primer
(F):5'- ATGGACCATGACTGGAGTCC -3'
(R):5'- TGTGCCCCAAGAGTCTAGATC -3'
Posted On2015-03-25