Incidental Mutation 'R3771:Fmn1'
ID273256
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission 040747-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R3771 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 113582118 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 996 (S996A)
Ref Sequence ENSEMBL: ENSMUSP00000125052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081349] [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
Predicted Effect probably damaging
Transcript: ENSMUST00000081349
AA Change: S868A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080093
Gene: ENSMUSG00000044042
AA Change: S868A

DomainStartEndE-ValueType
Blast:FH2 25 641 N/A BLAST
SCOP:d1jvr__ 668 699 2e-3 SMART
FH2 757 1162 1.16e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099576
AA Change: S1094A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: S1094A

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102547
AA Change: S1094A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: S1094A

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161731
AA Change: S996A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: S996A

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185668
AA Change: S943A
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,196 Y377H probably damaging Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Aanat G T 11: 116,596,871 G132V probably damaging Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adam26b T A 8: 43,520,714 D417V probably damaging Het
Ank1 T C 8: 23,123,897 S1482P probably benign Het
Armc2 C T 10: 41,922,227 V768M probably damaging Het
Ascc3 C T 10: 50,720,718 probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh12 A T 15: 21,578,554 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Cxcr6 A G 9: 123,810,485 I184V probably benign Het
Dagla G A 19: 10,248,467 P778S possibly damaging Het
Ddx19b T C 8: 111,020,981 K107R probably benign Het
Dpyd G A 3: 119,412,278 probably null Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Fam13a T G 6: 58,987,186 K87T probably benign Het
Fap C A 2: 62,533,010 S359I probably damaging Het
Fbxo39 T C 11: 72,317,215 I131T possibly damaging Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Irf2bp2 T C 8: 126,591,811 K339E probably damaging Het
Kat6b A G 14: 21,517,098 D75G probably damaging Het
Kcnab3 A G 11: 69,328,563 T127A probably damaging Het
Kdm5b G T 1: 134,613,345 C725F probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrn3 T A 12: 41,452,870 I483L probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Med23 G T 10: 24,902,201 G810C probably damaging Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Numb T C 12: 83,799,576 D344G probably damaging Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Ogg1 T C 6: 113,333,843 V317A possibly damaging Het
Olfr822 A G 10: 130,075,274 Y288C probably damaging Het
Olfr97 T A 17: 37,231,465 I302F possibly damaging Het
Pclo A T 5: 14,539,408 probably null Het
Pnpt1 T C 11: 29,138,174 M195T probably benign Het
Polr3c T A 3: 96,725,854 T43S probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rasl10b A T 11: 83,418,523 T134S probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Ros1 G T 10: 52,128,991 A949E probably damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tc2n T A 12: 101,694,574 Q133L possibly damaging Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tex2 T C 11: 106,546,894 D650G unknown Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugcg T C 4: 59,189,690 F16S probably benign Het
Usp16 T C 16: 87,458,683 M1T probably null Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Vpreb3 A T 10: 75,939,966 V26E probably benign Het
Vps39 C T 2: 120,342,016 V179I possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7440:Fmn1 UTSW 2 113441611 missense unknown
R7441:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
R7526:Fmn1 UTSW 2 113688134 missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113529310 splice site probably null
R7576:Fmn1 UTSW 2 113365008 missense unknown
R7657:Fmn1 UTSW 2 113525193 missense unknown
R7669:Fmn1 UTSW 2 113365477 missense unknown
R7713:Fmn1 UTSW 2 113525814 missense unknown
R7841:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R7924:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R8041:Fmn1 UTSW 2 113364594 missense unknown
RF003:Fmn1 UTSW 2 113525786 small insertion probably benign
RF023:Fmn1 UTSW 2 113525786 small insertion probably benign
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCACACCTGGTATTAGAGAAAGGG -3'
(R):5'- GAACCAATCTGCCTTGCTGG -3'

Sequencing Primer
(F):5'- GGAACCCAGACTGTCAGGC -3'
(R):5'- CCTTGCTGGGGTTAGAAGATCTACC -3'
Posted On2015-03-25