Incidental Mutation 'R3771:Med23'
ID273287
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission 040747-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3771 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24902201 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 810 (G810C)
Ref Sequence ENSEMBL: ENSMUSP00000020159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
Predicted Effect probably damaging
Transcript: ENSMUST00000020159
AA Change: G810C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: G810C

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092646
AA Change: G816C

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: G816C

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176285
AA Change: G450C

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: G450C

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176827
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Meta Mutation Damage Score 0.0719 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,196 Y377H probably damaging Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Aanat G T 11: 116,596,871 G132V probably damaging Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adam26b T A 8: 43,520,714 D417V probably damaging Het
Ank1 T C 8: 23,123,897 S1482P probably benign Het
Armc2 C T 10: 41,922,227 V768M probably damaging Het
Ascc3 C T 10: 50,720,718 probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh12 A T 15: 21,578,554 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Cxcr6 A G 9: 123,810,485 I184V probably benign Het
Dagla G A 19: 10,248,467 P778S possibly damaging Het
Ddx19b T C 8: 111,020,981 K107R probably benign Het
Dpyd G A 3: 119,412,278 probably null Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Fam13a T G 6: 58,987,186 K87T probably benign Het
Fap C A 2: 62,533,010 S359I probably damaging Het
Fbxo39 T C 11: 72,317,215 I131T possibly damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Irf2bp2 T C 8: 126,591,811 K339E probably damaging Het
Kat6b A G 14: 21,517,098 D75G probably damaging Het
Kcnab3 A G 11: 69,328,563 T127A probably damaging Het
Kdm5b G T 1: 134,613,345 C725F probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrn3 T A 12: 41,452,870 I483L probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Numb T C 12: 83,799,576 D344G probably damaging Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Ogg1 T C 6: 113,333,843 V317A possibly damaging Het
Olfr822 A G 10: 130,075,274 Y288C probably damaging Het
Olfr97 T A 17: 37,231,465 I302F possibly damaging Het
Pclo A T 5: 14,539,408 probably null Het
Pnpt1 T C 11: 29,138,174 M195T probably benign Het
Polr3c T A 3: 96,725,854 T43S probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rasl10b A T 11: 83,418,523 T134S probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Ros1 G T 10: 52,128,991 A949E probably damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tc2n T A 12: 101,694,574 Q133L possibly damaging Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tex2 T C 11: 106,546,894 D650G unknown Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugcg T C 4: 59,189,690 F16S probably benign Het
Usp16 T C 16: 87,458,683 M1T probably null Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Vpreb3 A T 10: 75,939,966 V26E probably benign Het
Vps39 C T 2: 120,342,016 V179I possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGGAAAGCCGTTTTAATCTG -3'
(R):5'- TTCCACACCATGTCGTTGAG -3'

Sequencing Primer
(F):5'- GCCGTTTTAATCTGAAGAAGAATGTG -3'
(R):5'- TCCTGCTGACGTAGAGAACTC -3'
Posted On2015-03-25