Incidental Mutation 'R3771:Tc2n'
ID273301
Institutional Source Beutler Lab
Gene Symbol Tc2n
Ensembl Gene ENSMUSG00000021187
Gene Nametandem C2 domains, nuclear
Synonyms4933406D09Rik, Tac2-N, Mtac2d1
MMRRC Submission 040747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3771 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location101645443-101718523 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101694574 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 133 (Q133L)
Ref Sequence ENSEMBL: ENSMUSP00000125099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110047] [ENSMUST00000160715] [ENSMUST00000160830] [ENSMUST00000162735]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110047
AA Change: Q133L

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105674
Gene: ENSMUSG00000021187
AA Change: Q133L

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160715
AA Change: Q133L

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125099
Gene: ENSMUSG00000021187
AA Change: Q133L

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
Blast:C2 238 287 1e-24 BLAST
C2 302 408 1.02e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160830
AA Change: Q133L

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124287
Gene: ENSMUSG00000021187
AA Change: Q133L

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162735
AA Change: Q133L

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125288
Gene: ENSMUSG00000021187
AA Change: Q133L

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Meta Mutation Damage Score 0.1123 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,196 Y377H probably damaging Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Aanat G T 11: 116,596,871 G132V probably damaging Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adam26b T A 8: 43,520,714 D417V probably damaging Het
Ank1 T C 8: 23,123,897 S1482P probably benign Het
Armc2 C T 10: 41,922,227 V768M probably damaging Het
Ascc3 C T 10: 50,720,718 probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh12 A T 15: 21,578,554 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Cxcr6 A G 9: 123,810,485 I184V probably benign Het
Dagla G A 19: 10,248,467 P778S possibly damaging Het
Ddx19b T C 8: 111,020,981 K107R probably benign Het
Dpyd G A 3: 119,412,278 probably null Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Fam13a T G 6: 58,987,186 K87T probably benign Het
Fap C A 2: 62,533,010 S359I probably damaging Het
Fbxo39 T C 11: 72,317,215 I131T possibly damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Irf2bp2 T C 8: 126,591,811 K339E probably damaging Het
Kat6b A G 14: 21,517,098 D75G probably damaging Het
Kcnab3 A G 11: 69,328,563 T127A probably damaging Het
Kdm5b G T 1: 134,613,345 C725F probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrn3 T A 12: 41,452,870 I483L probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Med23 G T 10: 24,902,201 G810C probably damaging Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Numb T C 12: 83,799,576 D344G probably damaging Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Ogg1 T C 6: 113,333,843 V317A possibly damaging Het
Olfr822 A G 10: 130,075,274 Y288C probably damaging Het
Olfr97 T A 17: 37,231,465 I302F possibly damaging Het
Pclo A T 5: 14,539,408 probably null Het
Pnpt1 T C 11: 29,138,174 M195T probably benign Het
Polr3c T A 3: 96,725,854 T43S probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rasl10b A T 11: 83,418,523 T134S probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Ros1 G T 10: 52,128,991 A949E probably damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tex2 T C 11: 106,546,894 D650G unknown Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugcg T C 4: 59,189,690 F16S probably benign Het
Usp16 T C 16: 87,458,683 M1T probably null Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Vpreb3 A T 10: 75,939,966 V26E probably benign Het
Vps39 C T 2: 120,342,016 V179I possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Tc2n
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Tc2n APN 12 101649089 utr 3 prime probably benign
IGL02129:Tc2n APN 12 101689789 missense probably damaging 0.99
IGL02630:Tc2n APN 12 101693145 missense probably damaging 0.99
R0517:Tc2n UTSW 12 101649195 missense probably damaging 0.98
R0980:Tc2n UTSW 12 101678576 nonsense probably null
R1676:Tc2n UTSW 12 101688992 missense probably damaging 1.00
R2187:Tc2n UTSW 12 101706544 missense probably damaging 1.00
R4082:Tc2n UTSW 12 101651155 missense possibly damaging 0.85
R4180:Tc2n UTSW 12 101665695 missense probably damaging 1.00
R4707:Tc2n UTSW 12 101694573 missense probably benign 0.16
R4793:Tc2n UTSW 12 101651117 missense possibly damaging 0.86
R4917:Tc2n UTSW 12 101665695 missense probably damaging 1.00
R5214:Tc2n UTSW 12 101693202 nonsense probably null
R5870:Tc2n UTSW 12 101652852 missense probably damaging 1.00
R6034:Tc2n UTSW 12 101651201 splice site probably null
R6034:Tc2n UTSW 12 101651201 splice site probably null
R6128:Tc2n UTSW 12 101709489 start codon destroyed probably null 0.99
R7200:Tc2n UTSW 12 101689055 missense probably damaging 1.00
R7469:Tc2n UTSW 12 101665675 missense probably damaging 1.00
R7471:Tc2n UTSW 12 101706457 missense probably damaging 0.99
R7730:Tc2n UTSW 12 101651147 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACCAGAAAGAAGTCATAATGCTTATC -3'
(R):5'- GCTGGTTAAGGCATATGCTTTATGAC -3'

Sequencing Primer
(F):5'- ACATTTGTGAATTCTGCTTTGCTC -3'
(R):5'- TGACAAAGTATTTTTAACCTGTCCC -3'
Posted On2015-03-25