Incidental Mutation 'R3771:Rnf39'
ID273315
Institutional Source Beutler Lab
Gene Symbol Rnf39
Ensembl Gene ENSMUSG00000036492
Gene Namering finger protein 39
SynonymsLOC240094, LIRF, LOC386454, LOC386465
MMRRC Submission 040747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3771 (G1)
Quality Score97
Status Validated
Chromosome17
Chromosomal Location36942918-36947986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36947229 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 96 (W96R)
Ref Sequence ENSEMBL: ENSMUSP00000134113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040402] [ENSMUST00000040498] [ENSMUST00000173072] [ENSMUST00000173540] [ENSMUST00000174669] [ENSMUST00000174711]
Predicted Effect probably benign
Transcript: ENSMUST00000040402
SMART Domains Protein: ENSMUSP00000047202
Gene: ENSMUSG00000036398

DomainStartEndE-ValueType
Pfam:PPI_Ypi1 22 87 8.7e-26 PFAM
low complexity region 105 128 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000040498
AA Change: W218R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037860
Gene: ENSMUSG00000036492
AA Change: W218R

DomainStartEndE-ValueType
RING 20 66 3.47e-4 SMART
low complexity region 99 109 N/A INTRINSIC
PRY 159 212 6.23e-15 SMART
Blast:SPRY 213 349 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173072
SMART Domains Protein: ENSMUSP00000133710
Gene: ENSMUSG00000036492

DomainStartEndE-ValueType
RING 20 66 3.47e-4 SMART
low complexity region 99 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173540
SMART Domains Protein: ENSMUSP00000134322
Gene: ENSMUSG00000036398

DomainStartEndE-ValueType
Pfam:PPI_Ypi1 5 77 2e-24 PFAM
low complexity region 94 117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174669
AA Change: W96R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134113
Gene: ENSMUSG00000036492
AA Change: W96R

DomainStartEndE-ValueType
PRY 37 90 6.23e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174711
SMART Domains Protein: ENSMUSP00000134685
Gene: ENSMUSG00000036398

DomainStartEndE-ValueType
Pfam:PPI_Ypi1 22 87 8.7e-26 PFAM
low complexity region 105 128 N/A INTRINSIC
Meta Mutation Damage Score 0.8536 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene lies within the major histocompatibility complex class I region on chromosome 6. Studies of a similar rat protein suggest that this gene encodes a protein that plays a role in an early phase of synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,196 Y377H probably damaging Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Aanat G T 11: 116,596,871 G132V probably damaging Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adam26b T A 8: 43,520,714 D417V probably damaging Het
Ank1 T C 8: 23,123,897 S1482P probably benign Het
Armc2 C T 10: 41,922,227 V768M probably damaging Het
Ascc3 C T 10: 50,720,718 probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh12 A T 15: 21,578,554 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Cxcr6 A G 9: 123,810,485 I184V probably benign Het
Dagla G A 19: 10,248,467 P778S possibly damaging Het
Ddx19b T C 8: 111,020,981 K107R probably benign Het
Dpyd G A 3: 119,412,278 probably null Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Fam13a T G 6: 58,987,186 K87T probably benign Het
Fap C A 2: 62,533,010 S359I probably damaging Het
Fbxo39 T C 11: 72,317,215 I131T possibly damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Irf2bp2 T C 8: 126,591,811 K339E probably damaging Het
Kat6b A G 14: 21,517,098 D75G probably damaging Het
Kcnab3 A G 11: 69,328,563 T127A probably damaging Het
Kdm5b G T 1: 134,613,345 C725F probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrn3 T A 12: 41,452,870 I483L probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Med23 G T 10: 24,902,201 G810C probably damaging Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Numb T C 12: 83,799,576 D344G probably damaging Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Ogg1 T C 6: 113,333,843 V317A possibly damaging Het
Olfr822 A G 10: 130,075,274 Y288C probably damaging Het
Olfr97 T A 17: 37,231,465 I302F possibly damaging Het
Pclo A T 5: 14,539,408 probably null Het
Pnpt1 T C 11: 29,138,174 M195T probably benign Het
Polr3c T A 3: 96,725,854 T43S probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rasl10b A T 11: 83,418,523 T134S probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ros1 G T 10: 52,128,991 A949E probably damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tc2n T A 12: 101,694,574 Q133L possibly damaging Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tex2 T C 11: 106,546,894 D650G unknown Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugcg T C 4: 59,189,690 F16S probably benign Het
Usp16 T C 16: 87,458,683 M1T probably null Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Vpreb3 A T 10: 75,939,966 V26E probably benign Het
Vps39 C T 2: 120,342,016 V179I possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Rnf39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Rnf39 APN 17 36945436 missense possibly damaging 0.84
IGL02852:Rnf39 APN 17 36945202 unclassified probably benign
R3967:Rnf39 UTSW 17 36943143 missense probably damaging 1.00
R5026:Rnf39 UTSW 17 36945534 missense probably benign 0.18
R5294:Rnf39 UTSW 17 36947200 missense probably damaging 1.00
R6139:Rnf39 UTSW 17 36943338 missense probably damaging 1.00
R6699:Rnf39 UTSW 17 36947229 missense probably damaging 1.00
R7396:Rnf39 UTSW 17 36947079 missense probably damaging 0.98
R7436:Rnf39 UTSW 17 36943349 missense probably benign 0.39
R7536:Rnf39 UTSW 17 36943117 missense probably damaging 1.00
R7888:Rnf39 UTSW 17 36947241 missense probably damaging 0.99
R8164:Rnf39 UTSW 17 36943400 missense probably damaging 0.98
X0067:Rnf39 UTSW 17 36943266 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCTTCTGCAGCTGACCTGAC -3'
(R):5'- AGTCCAAGTCCACGCGAATG -3'

Sequencing Primer
(F):5'- AGCTGACCTGACGCTCGAC -3'
(R):5'- TGGCACCACCTAGCAGG -3'
Posted On2015-03-25