Incidental Mutation 'R3772:Lamc2'
ID273328
Institutional Source Beutler Lab
Gene Symbol Lamc2
Ensembl Gene ENSMUSG00000026479
Gene Namelaminin, gamma 2
Synonymsnicein, 100kDa
MMRRC Submission 040748-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.762) question?
Stock #R3772 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location153122756-153186447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 153124251 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1121 (M1121L)
Ref Sequence ENSEMBL: ENSMUSP00000140514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000043313] [ENSMUST00000185356] [ENSMUST00000188206]
Predicted Effect probably benign
Transcript: ENSMUST00000027753
AA Change: M1121L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: M1121L

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043313
SMART Domains Protein: ENSMUSP00000041110
Gene: ENSMUSG00000042751

DomainStartEndE-ValueType
Pfam:CTP_transf_like 12 276 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185356
AA Change: M1121L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: M1121L

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189005
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adgrl1 A G 8: 83,923,004 N97S possibly damaging Het
Aldh1a2 A G 9: 71,252,920 D76G probably damaging Het
Aldh3a1 A G 11: 61,214,605 E179G possibly damaging Het
Ap1g1 A G 8: 109,837,786 D324G probably damaging Het
Arfgap2 A G 2: 91,265,366 T12A probably benign Het
Aurka A G 2: 172,366,960 L85P probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Bmp7 A T 2: 172,870,222 I403N probably damaging Het
Carns1 A G 19: 4,170,916 probably benign Het
Ccdc88c G A 12: 100,966,100 probably benign Het
Ccl2 C T 11: 82,036,958 A76V probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Col24a1 T C 3: 145,545,286 L1680P probably damaging Het
Col4a6 C A X: 141,172,200 G1416C probably damaging Het
Ctnna2 T G 6: 76,973,769 N573T probably damaging Het
Cts8 G A 13: 61,250,901 probably benign Het
Cxcl17 A G 7: 25,400,329 probably benign Het
Defb18 T C 1: 18,236,621 H37R possibly damaging Het
Dis3l2 T C 1: 86,854,408 I229T probably benign Het
Dysf G A 6: 84,152,351 S1474N possibly damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
F13a1 T C 13: 36,898,134 K532R probably benign Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Focad A C 4: 88,336,161 probably benign Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Frrs1 T G 3: 116,878,387 S45A possibly damaging Het
Gm5422 T A 10: 31,248,514 noncoding transcript Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Iglon5 A T 7: 43,480,613 Y42* probably null Het
Khdrbs2 C T 1: 32,244,076 Q90* probably null Het
Krt74 T C 15: 101,762,195 noncoding transcript Het
Lrig1 A G 6: 94,605,817 L1073P probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Megf10 G A 18: 57,283,862 D768N probably benign Het
Mycbp2 T C 14: 103,133,788 N4108S possibly damaging Het
Nid1 A G 13: 13,476,418 probably benign Het
Nnt A G 13: 119,396,952 V59A probably damaging Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Olfr99 T C 17: 37,279,854 T189A probably benign Het
Pag1 G A 3: 9,699,628 T155M probably benign Het
Pgam5 T C 5: 110,265,593 H176R probably damaging Het
Pid1 T C 1: 84,038,197 D149G probably damaging Het
Pkp3 G A 7: 141,082,346 M1I probably null Het
Pld2 C T 11: 70,544,123 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rab9b T A X: 136,861,449 E67D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf214 T C 9: 45,866,634 M625V possibly damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Sept10 A T 10: 59,176,887 M303K probably damaging Het
Sez6l2 A G 7: 126,959,203 E339G probably damaging Het
Sf3b1 C A 1: 54,999,991 probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
St18 A T 1: 6,844,329 K799I probably damaging Het
Strada C T 11: 106,164,822 R333Q probably damaging Het
Stradb A T 1: 58,985,385 I64L probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tnk2 A G 16: 32,679,822 D651G probably damaging Het
Trim43c A T 9: 88,847,757 D417V probably damaging Het
Tsc22d4 T C 5: 137,759,233 L374P possibly damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ubr4 T C 4: 139,452,700 V262A possibly damaging Het
Vmn2r60 A T 7: 42,116,556 N29I probably benign Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 C T 15: 88,780,787 P353S probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zwilch A T 9: 64,156,034 F286I probably benign Het
Other mutations in Lamc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Lamc2 APN 1 153130056 missense probably benign 0.00
IGL00907:Lamc2 APN 1 153144651 missense probably benign 0.32
IGL02026:Lamc2 APN 1 153144736 splice site probably benign
IGL02335:Lamc2 APN 1 153166216 missense probably benign 0.00
IGL02568:Lamc2 APN 1 153166262 missense possibly damaging 0.91
IGL02640:Lamc2 APN 1 153152057 missense probably damaging 0.99
IGL02801:Lamc2 APN 1 153136783 missense probably benign 0.10
IGL02827:Lamc2 APN 1 153139781 missense probably damaging 1.00
IGL03240:Lamc2 APN 1 153124125 missense probably damaging 1.00
IGL03245:Lamc2 APN 1 153133757 splice site probably null
ANU74:Lamc2 UTSW 1 153131835 missense probably benign 0.00
R0279:Lamc2 UTSW 1 153130696 missense probably benign 0.01
R0528:Lamc2 UTSW 1 153124094 missense probably damaging 1.00
R0597:Lamc2 UTSW 1 153133621 missense probably benign 0.02
R0650:Lamc2 UTSW 1 153143876 missense possibly damaging 0.88
R0826:Lamc2 UTSW 1 153152082 missense probably damaging 1.00
R1015:Lamc2 UTSW 1 153166199 missense possibly damaging 0.53
R1172:Lamc2 UTSW 1 153166287 missense probably damaging 1.00
R1308:Lamc2 UTSW 1 153150818 missense probably damaging 1.00
R1521:Lamc2 UTSW 1 153166263 missense probably benign 0.11
R1525:Lamc2 UTSW 1 153130756 missense probably benign 0.00
R1602:Lamc2 UTSW 1 153127028 missense probably benign 0.00
R1631:Lamc2 UTSW 1 153158934 missense possibly damaging 0.95
R1633:Lamc2 UTSW 1 153141698 nonsense probably null
R1832:Lamc2 UTSW 1 153166187 missense possibly damaging 0.72
R1978:Lamc2 UTSW 1 153133597 critical splice donor site probably null
R1996:Lamc2 UTSW 1 153154470 missense possibly damaging 0.84
R2046:Lamc2 UTSW 1 153141765 missense probably benign 0.01
R2107:Lamc2 UTSW 1 153154386 splice site probably benign
R2130:Lamc2 UTSW 1 153127124 missense probably damaging 1.00
R2182:Lamc2 UTSW 1 153126866 missense possibly damaging 0.46
R2207:Lamc2 UTSW 1 153133706 missense possibly damaging 0.68
R2218:Lamc2 UTSW 1 153130779 missense probably benign 0.21
R4616:Lamc2 UTSW 1 153166169 missense probably damaging 1.00
R4874:Lamc2 UTSW 1 153154395 missense probably null 1.00
R4939:Lamc2 UTSW 1 153126836 missense probably damaging 1.00
R4985:Lamc2 UTSW 1 153136805 missense probably benign
R5544:Lamc2 UTSW 1 153124053 missense possibly damaging 0.93
R5632:Lamc2 UTSW 1 153131890 missense probably damaging 1.00
R5771:Lamc2 UTSW 1 153141594 missense probably benign 0.04
R5811:Lamc2 UTSW 1 153166253 missense possibly damaging 0.53
R6058:Lamc2 UTSW 1 153136829 missense probably benign 0.01
R6130:Lamc2 UTSW 1 153136777 missense probably benign 0.01
R6137:Lamc2 UTSW 1 153166153 missense possibly damaging 0.90
R6994:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6995:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6997:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R7000:Lamc2 UTSW 1 153166127 missense possibly damaging 0.72
R7018:Lamc2 UTSW 1 153136742 missense probably benign 0.00
R7145:Lamc2 UTSW 1 153130772 missense possibly damaging 0.95
R7148:Lamc2 UTSW 1 153185984 missense probably benign 0.01
R7171:Lamc2 UTSW 1 153139749 missense probably damaging 1.00
R7640:Lamc2 UTSW 1 153136804 missense possibly damaging 0.79
R7673:Lamc2 UTSW 1 153124036 missense probably damaging 1.00
R7684:Lamc2 UTSW 1 153127025 missense probably null 0.86
R7712:Lamc2 UTSW 1 153133611 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TTGTCTCGAATGTTCTCCAGG -3'
(R):5'- GGCTGTTCAGAGCACAGATG -3'

Sequencing Primer
(F):5'- CAGGTTCTTCACATCAGCTAGAATTC -3'
(R):5'- ACAGATGCAGGCCTCATGTTCTTAG -3'
Posted On2015-03-25