Incidental Mutation 'R3772:Fmn1'
ID273336
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission 040748-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R3772 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 113582118 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 996 (S996A)
Ref Sequence ENSEMBL: ENSMUSP00000125052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081349] [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
Predicted Effect probably damaging
Transcript: ENSMUST00000081349
AA Change: S868A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080093
Gene: ENSMUSG00000044042
AA Change: S868A

DomainStartEndE-ValueType
Blast:FH2 25 641 N/A BLAST
SCOP:d1jvr__ 668 699 2e-3 SMART
FH2 757 1162 1.16e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099576
AA Change: S1094A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: S1094A

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102547
AA Change: S1094A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: S1094A

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161731
AA Change: S996A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: S996A

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185668
AA Change: S943A
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adgrl1 A G 8: 83,923,004 N97S possibly damaging Het
Aldh1a2 A G 9: 71,252,920 D76G probably damaging Het
Aldh3a1 A G 11: 61,214,605 E179G possibly damaging Het
Ap1g1 A G 8: 109,837,786 D324G probably damaging Het
Arfgap2 A G 2: 91,265,366 T12A probably benign Het
Aurka A G 2: 172,366,960 L85P probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Bmp7 A T 2: 172,870,222 I403N probably damaging Het
Carns1 A G 19: 4,170,916 probably benign Het
Ccdc88c G A 12: 100,966,100 probably benign Het
Ccl2 C T 11: 82,036,958 A76V probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Col24a1 T C 3: 145,545,286 L1680P probably damaging Het
Col4a6 C A X: 141,172,200 G1416C probably damaging Het
Ctnna2 T G 6: 76,973,769 N573T probably damaging Het
Cts8 G A 13: 61,250,901 probably benign Het
Cxcl17 A G 7: 25,400,329 probably benign Het
Defb18 T C 1: 18,236,621 H37R possibly damaging Het
Dis3l2 T C 1: 86,854,408 I229T probably benign Het
Dysf G A 6: 84,152,351 S1474N possibly damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
F13a1 T C 13: 36,898,134 K532R probably benign Het
Focad A C 4: 88,336,161 probably benign Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Frrs1 T G 3: 116,878,387 S45A possibly damaging Het
Gm5422 T A 10: 31,248,514 noncoding transcript Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Iglon5 A T 7: 43,480,613 Y42* probably null Het
Khdrbs2 C T 1: 32,244,076 Q90* probably null Het
Krt74 T C 15: 101,762,195 noncoding transcript Het
Lamc2 T A 1: 153,124,251 M1121L probably benign Het
Lrig1 A G 6: 94,605,817 L1073P probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Megf10 G A 18: 57,283,862 D768N probably benign Het
Mycbp2 T C 14: 103,133,788 N4108S possibly damaging Het
Nid1 A G 13: 13,476,418 probably benign Het
Nnt A G 13: 119,396,952 V59A probably damaging Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Olfr99 T C 17: 37,279,854 T189A probably benign Het
Pag1 G A 3: 9,699,628 T155M probably benign Het
Pgam5 T C 5: 110,265,593 H176R probably damaging Het
Pid1 T C 1: 84,038,197 D149G probably damaging Het
Pkp3 G A 7: 141,082,346 M1I probably null Het
Pld2 C T 11: 70,544,123 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rab9b T A X: 136,861,449 E67D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf214 T C 9: 45,866,634 M625V possibly damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Sept10 A T 10: 59,176,887 M303K probably damaging Het
Sez6l2 A G 7: 126,959,203 E339G probably damaging Het
Sf3b1 C A 1: 54,999,991 probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
St18 A T 1: 6,844,329 K799I probably damaging Het
Strada C T 11: 106,164,822 R333Q probably damaging Het
Stradb A T 1: 58,985,385 I64L probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tnk2 A G 16: 32,679,822 D651G probably damaging Het
Trim43c A T 9: 88,847,757 D417V probably damaging Het
Tsc22d4 T C 5: 137,759,233 L374P possibly damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ubr4 T C 4: 139,452,700 V262A possibly damaging Het
Vmn2r60 A T 7: 42,116,556 N29I probably benign Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 C T 15: 88,780,787 P353S probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zwilch A T 9: 64,156,034 F286I probably benign Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7440:Fmn1 UTSW 2 113441611 missense unknown
R7441:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
R7526:Fmn1 UTSW 2 113688134 missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113529310 splice site probably null
R7576:Fmn1 UTSW 2 113365008 missense unknown
R7657:Fmn1 UTSW 2 113525193 missense unknown
R7669:Fmn1 UTSW 2 113365477 missense unknown
R7713:Fmn1 UTSW 2 113525814 missense unknown
R7841:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R7924:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R8041:Fmn1 UTSW 2 113364594 missense unknown
RF003:Fmn1 UTSW 2 113525786 small insertion probably benign
RF023:Fmn1 UTSW 2 113525786 small insertion probably benign
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCACACCTGGTATTAGAGAAAGG -3'
(R):5'- AACCAATCTGCCTTGCTGGG -3'

Sequencing Primer
(F):5'- CACCTGGTATTAGAGAAAGGGGAAC -3'
(R):5'- CCTTGCTGGGGTTAGAAGATCTACC -3'
Posted On2015-03-25