Incidental Mutation 'R3772:Bmp7'
ID273340
Institutional Source Beutler Lab
Gene Symbol Bmp7
Ensembl Gene ENSMUSG00000008999
Gene Namebone morphogenetic protein 7
Synonymsosteogenic protein 1, OP1
MMRRC Submission 040748-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3772 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172868012-172940321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 172870222 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 403 (I403N)
Ref Sequence ENSEMBL: ENSMUSP00000009143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009143]
Predicted Effect probably damaging
Transcript: ENSMUST00000009143
AA Change: I403N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009143
Gene: ENSMUSG00000008999
AA Change: I403N

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:TGFb_propeptide 34 279 4.3e-97 PFAM
TGFB 329 430 2.14e-68 SMART
Meta Mutation Damage Score 0.312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. Mutation of this gene results in skeletal, kidney, and other developmental defects. [provided by RefSeq, Jul 2016]
PHENOTYPE: Various homozygous targeted mutations result in postnatal lethality, a wide range of skeletal and cartilage abnormalities, renal dysplasia and polycystic kidney, and eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adgrl1 A G 8: 83,923,004 N97S possibly damaging Het
Aldh1a2 A G 9: 71,252,920 D76G probably damaging Het
Aldh3a1 A G 11: 61,214,605 E179G possibly damaging Het
Ap1g1 A G 8: 109,837,786 D324G probably damaging Het
Arfgap2 A G 2: 91,265,366 T12A probably benign Het
Aurka A G 2: 172,366,960 L85P probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Carns1 A G 19: 4,170,916 probably benign Het
Ccdc88c G A 12: 100,966,100 probably benign Het
Ccl2 C T 11: 82,036,958 A76V probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Col24a1 T C 3: 145,545,286 L1680P probably damaging Het
Col4a6 C A X: 141,172,200 G1416C probably damaging Het
Ctnna2 T G 6: 76,973,769 N573T probably damaging Het
Cts8 G A 13: 61,250,901 probably benign Het
Cxcl17 A G 7: 25,400,329 probably benign Het
Defb18 T C 1: 18,236,621 H37R possibly damaging Het
Dis3l2 T C 1: 86,854,408 I229T probably benign Het
Dysf G A 6: 84,152,351 S1474N possibly damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
F13a1 T C 13: 36,898,134 K532R probably benign Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Focad A C 4: 88,336,161 probably benign Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Frrs1 T G 3: 116,878,387 S45A possibly damaging Het
Gm5422 T A 10: 31,248,514 noncoding transcript Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Iglon5 A T 7: 43,480,613 Y42* probably null Het
Khdrbs2 C T 1: 32,244,076 Q90* probably null Het
Krt74 T C 15: 101,762,195 noncoding transcript Het
Lamc2 T A 1: 153,124,251 M1121L probably benign Het
Lrig1 A G 6: 94,605,817 L1073P probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Megf10 G A 18: 57,283,862 D768N probably benign Het
Mycbp2 T C 14: 103,133,788 N4108S possibly damaging Het
Nid1 A G 13: 13,476,418 probably benign Het
Nnt A G 13: 119,396,952 V59A probably damaging Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Olfr99 T C 17: 37,279,854 T189A probably benign Het
Pag1 G A 3: 9,699,628 T155M probably benign Het
Pgam5 T C 5: 110,265,593 H176R probably damaging Het
Pid1 T C 1: 84,038,197 D149G probably damaging Het
Pkp3 G A 7: 141,082,346 M1I probably null Het
Pld2 C T 11: 70,544,123 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rab9b T A X: 136,861,449 E67D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf214 T C 9: 45,866,634 M625V possibly damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Sept10 A T 10: 59,176,887 M303K probably damaging Het
Sez6l2 A G 7: 126,959,203 E339G probably damaging Het
Sf3b1 C A 1: 54,999,991 probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
St18 A T 1: 6,844,329 K799I probably damaging Het
Strada C T 11: 106,164,822 R333Q probably damaging Het
Stradb A T 1: 58,985,385 I64L probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tnk2 A G 16: 32,679,822 D651G probably damaging Het
Trim43c A T 9: 88,847,757 D417V probably damaging Het
Tsc22d4 T C 5: 137,759,233 L374P possibly damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ubr4 T C 4: 139,452,700 V262A possibly damaging Het
Vmn2r60 A T 7: 42,116,556 N29I probably benign Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 C T 15: 88,780,787 P353S probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zwilch A T 9: 64,156,034 F286I probably benign Het
Other mutations in Bmp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Bmp7 APN 2 172875262 missense probably damaging 1.00
IGL01143:Bmp7 APN 2 172879482 missense probably benign
IGL01636:Bmp7 APN 2 172875208 splice site probably benign
IGL02331:Bmp7 APN 2 172872931 missense probably damaging 1.00
IGL03211:Bmp7 APN 2 172872883 missense possibly damaging 0.70
R1957:Bmp7 UTSW 2 172939921 missense probably damaging 0.97
R2044:Bmp7 UTSW 2 172939915 missense possibly damaging 0.46
R4392:Bmp7 UTSW 2 172916542 missense probably benign 0.25
R6716:Bmp7 UTSW 2 172872889 missense probably damaging 1.00
R6774:Bmp7 UTSW 2 172872958 missense probably damaging 1.00
R6864:Bmp7 UTSW 2 172940062 missense probably benign 0.00
R6904:Bmp7 UTSW 2 172872913 missense probably damaging 0.97
R7295:Bmp7 UTSW 2 172939897 missense probably damaging 1.00
R7390:Bmp7 UTSW 2 172870205 missense probably damaging 1.00
R7392:Bmp7 UTSW 2 172870205 missense probably damaging 1.00
R7560:Bmp7 UTSW 2 172939964 missense possibly damaging 0.85
X0024:Bmp7 UTSW 2 172939801 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GGAACCCTTACATGCTTCCG -3'
(R):5'- GTCCTTTATGGTCATCTTAGCCAG -3'

Sequencing Primer
(F):5'- CCTTACATGCTTCCGGTTGGG -3'
(R):5'- TGGTCATCTTAGCCAGAGAATAG -3'
Posted On2015-03-25