Incidental Mutation 'R3772:Ctnna2'
ID273349
Institutional Source Beutler Lab
Gene Symbol Ctnna2
Ensembl Gene ENSMUSG00000063063
Gene Namecatenin (cadherin associated protein), alpha 2
Synonymschp, Catna, alpha N-catenin, alpha(N)-catenin, Catna2
MMRRC Submission 040748-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R3772 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location76881637-77979699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 76973769 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 573 (N573T)
Ref Sequence ENSEMBL: ENSMUSP00000124764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075340] [ENSMUST00000159626] [ENSMUST00000160894] [ENSMUST00000161846] [ENSMUST00000204527]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075340
AA Change: N560T

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074809
Gene: ENSMUSG00000063063
AA Change: N560T

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 2e-104 PFAM
Pfam:Vinculin 331 866 7.7e-222 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159626
AA Change: N560T

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124376
Gene: ENSMUSG00000063063
AA Change: N560T

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 3.4e-105 PFAM
Pfam:Vinculin 330 914 6.6e-214 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160894
AA Change: N573T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124764
Gene: ENSMUSG00000063063
AA Change: N573T

DomainStartEndE-ValueType
Pfam:Vinculin 31 352 2.1e-104 PFAM
Pfam:Vinculin 343 927 4.6e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161846
AA Change: N573T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123714
Gene: ENSMUSG00000063063
AA Change: N573T

DomainStartEndE-ValueType
Pfam:Vinculin 31 350 5.3e-105 PFAM
Pfam:Vinculin 344 879 2.1e-222 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204527
AA Change: N208T

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144890
Gene: ENSMUSG00000063063
AA Change: N208T

DomainStartEndE-ValueType
Pfam:Vinculin 2 232 2.9e-94 PFAM
Meta Mutation Damage Score 0.3059 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (77/77)
MGI Phenotype PHENOTYPE: Animals homozygous for a mutation of this gene exhibit ataxia, reduced body weight, reduced male fertility, and abnormalities of the brain which include a hypoplastic cerebellum, abnormal foliation pattern, ectopic Purkinje cells, and abnormal pyramidal cells in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adgrl1 A G 8: 83,923,004 N97S possibly damaging Het
Aldh1a2 A G 9: 71,252,920 D76G probably damaging Het
Aldh3a1 A G 11: 61,214,605 E179G possibly damaging Het
Ap1g1 A G 8: 109,837,786 D324G probably damaging Het
Arfgap2 A G 2: 91,265,366 T12A probably benign Het
Aurka A G 2: 172,366,960 L85P probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Bmp7 A T 2: 172,870,222 I403N probably damaging Het
Carns1 A G 19: 4,170,916 probably benign Het
Ccdc88c G A 12: 100,966,100 probably benign Het
Ccl2 C T 11: 82,036,958 A76V probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Col24a1 T C 3: 145,545,286 L1680P probably damaging Het
Col4a6 C A X: 141,172,200 G1416C probably damaging Het
Cts8 G A 13: 61,250,901 probably benign Het
Cxcl17 A G 7: 25,400,329 probably benign Het
Defb18 T C 1: 18,236,621 H37R possibly damaging Het
Dis3l2 T C 1: 86,854,408 I229T probably benign Het
Dysf G A 6: 84,152,351 S1474N possibly damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
F13a1 T C 13: 36,898,134 K532R probably benign Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Focad A C 4: 88,336,161 probably benign Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Frrs1 T G 3: 116,878,387 S45A possibly damaging Het
Gm5422 T A 10: 31,248,514 noncoding transcript Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Iglon5 A T 7: 43,480,613 Y42* probably null Het
Khdrbs2 C T 1: 32,244,076 Q90* probably null Het
Krt74 T C 15: 101,762,195 noncoding transcript Het
Lamc2 T A 1: 153,124,251 M1121L probably benign Het
Lrig1 A G 6: 94,605,817 L1073P probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Megf10 G A 18: 57,283,862 D768N probably benign Het
Mycbp2 T C 14: 103,133,788 N4108S possibly damaging Het
Nid1 A G 13: 13,476,418 probably benign Het
Nnt A G 13: 119,396,952 V59A probably damaging Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Olfr99 T C 17: 37,279,854 T189A probably benign Het
Pag1 G A 3: 9,699,628 T155M probably benign Het
Pgam5 T C 5: 110,265,593 H176R probably damaging Het
Pid1 T C 1: 84,038,197 D149G probably damaging Het
Pkp3 G A 7: 141,082,346 M1I probably null Het
Pld2 C T 11: 70,544,123 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rab9b T A X: 136,861,449 E67D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf214 T C 9: 45,866,634 M625V possibly damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Sept10 A T 10: 59,176,887 M303K probably damaging Het
Sez6l2 A G 7: 126,959,203 E339G probably damaging Het
Sf3b1 C A 1: 54,999,991 probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
St18 A T 1: 6,844,329 K799I probably damaging Het
Strada C T 11: 106,164,822 R333Q probably damaging Het
Stradb A T 1: 58,985,385 I64L probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tnk2 A G 16: 32,679,822 D651G probably damaging Het
Trim43c A T 9: 88,847,757 D417V probably damaging Het
Tsc22d4 T C 5: 137,759,233 L374P possibly damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ubr4 T C 4: 139,452,700 V262A possibly damaging Het
Vmn2r60 A T 7: 42,116,556 N29I probably benign Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 C T 15: 88,780,787 P353S probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zwilch A T 9: 64,156,034 F286I probably benign Het
Other mutations in Ctnna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ctnna2 APN 6 76980761 missense probably damaging 1.00
IGL00573:Ctnna2 APN 6 76902281 intron probably benign
IGL01290:Ctnna2 APN 6 76882560 missense possibly damaging 0.89
IGL01719:Ctnna2 APN 6 77636975 nonsense probably null
IGL01725:Ctnna2 APN 6 77641365 missense possibly damaging 0.89
IGL02381:Ctnna2 APN 6 76954783 missense probably benign 0.27
IGL02561:Ctnna2 APN 6 77845580 missense probably benign 0.34
IGL02653:Ctnna2 APN 6 76980777 missense probably benign 0.00
IGL02658:Ctnna2 APN 6 76980824 missense probably benign 0.00
IGL02721:Ctnna2 APN 6 76981869 missense probably damaging 0.99
IGL03075:Ctnna2 APN 6 76954730 missense probably benign 0.14
IGL03291:Ctnna2 APN 6 76973712 missense probably damaging 1.00
R0379:Ctnna2 UTSW 6 77641440 missense probably benign 0.01
R0423:Ctnna2 UTSW 6 77653069 missense probably damaging 1.00
R0539:Ctnna2 UTSW 6 76973899 missense probably damaging 1.00
R0540:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R0545:Ctnna2 UTSW 6 77605182 missense probably damaging 1.00
R0559:Ctnna2 UTSW 6 76915850 missense probably damaging 1.00
R0582:Ctnna2 UTSW 6 77758417 missense probably benign 0.07
R0607:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R1318:Ctnna2 UTSW 6 76882790 missense probably damaging 1.00
R1754:Ctnna2 UTSW 6 77636749 missense possibly damaging 0.61
R1838:Ctnna2 UTSW 6 77845542 missense probably damaging 0.99
R1924:Ctnna2 UTSW 6 76954847 missense possibly damaging 0.75
R1969:Ctnna2 UTSW 6 77758500 missense probably damaging 0.99
R2011:Ctnna2 UTSW 6 76973791 missense possibly damaging 0.47
R2867:Ctnna2 UTSW 6 77114922 splice site probably benign
R3103:Ctnna2 UTSW 6 77653144 missense possibly damaging 0.66
R3809:Ctnna2 UTSW 6 76954757 missense probably damaging 0.99
R4023:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4024:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4025:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4026:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4288:Ctnna2 UTSW 6 77605221 missense probably damaging 0.96
R4291:Ctnna2 UTSW 6 76882745 missense probably damaging 1.00
R4493:Ctnna2 UTSW 6 76981848 missense probably damaging 0.99
R4561:Ctnna2 UTSW 6 77636713 critical splice donor site probably null
R4824:Ctnna2 UTSW 6 76980781 missense probably damaging 1.00
R4960:Ctnna2 UTSW 6 77653111 missense probably damaging 1.00
R4999:Ctnna2 UTSW 6 76915762 missense possibly damaging 0.86
R5041:Ctnna2 UTSW 6 76915763 missense probably damaging 1.00
R5093:Ctnna2 UTSW 6 77114929 critical splice donor site probably null
R5411:Ctnna2 UTSW 6 77114931 missense probably damaging 1.00
R5847:Ctnna2 UTSW 6 76973837 missense possibly damaging 0.87
R5874:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R5935:Ctnna2 UTSW 6 77143921 missense probably benign 0.01
R6008:Ctnna2 UTSW 6 76915828 missense probably damaging 1.00
R6115:Ctnna2 UTSW 6 77636839 missense probably benign 0.10
R6369:Ctnna2 UTSW 6 76980695 missense possibly damaging 0.88
R6490:Ctnna2 UTSW 6 77143909 missense probably benign
R7021:Ctnna2 UTSW 6 77636905 missense probably damaging 1.00
R7152:Ctnna2 UTSW 6 76980824 missense possibly damaging 0.48
R7662:Ctnna2 UTSW 6 77636869 missense probably damaging 1.00
R7804:Ctnna2 UTSW 6 77641374 missense probably benign 0.00
R7935:Ctnna2 UTSW 6 76942287 missense probably damaging 1.00
R8479:Ctnna2 UTSW 6 77758590 missense probably damaging 1.00
Z1177:Ctnna2 UTSW 6 76973781 missense possibly damaging 0.94
Z1177:Ctnna2 UTSW 6 76980740 missense probably damaging 1.00
Z1177:Ctnna2 UTSW 6 77641417 missense probably benign 0.01
Z1177:Ctnna2 UTSW 6 77758554 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTCTCCTGGTATCCAAATCCAAAC -3'
(R):5'- TCACTAGGTTGTTAGTAGCACAGG -3'

Sequencing Primer
(F):5'- CTCCCATGATACATACAAATTAGAGG -3'
(R):5'- CAGGTTATATAAACATGTATGTGCCC -3'
Posted On2015-03-25