Mutagenetix > Incidental Mutations

Incidental Mutation 'R3772:Cd109'

273366

Institutional Source

Beutler Lab

Gene Symbol

Cd109

Ensembl Gene

ENSMUSG00000046186

Gene Name

CD109 antigen

Synonyms

Gov platelet alloantigens, 9930012E15Rik

MMRRC Submission

040748-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3772 (G1)

Quality Score

199

Status

Validated

Chromosome

Chromosomal Location

78615546-78716253 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT at 78712500 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000091330 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093812]

Predicted Effect

probably benign
Transcript: ENSMUST00000093812

SMART Domains

Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:A2M_N	129	220	1.5e-16	PFAM
A2M_N_2	470	601	8.89e-32	SMART
A2M	695	786	2.07e-32	SMART
Pfam:Thiol-ester_cl	912	941	2.6e-20	PFAM
Pfam:A2M_comp	961	1197	1.9e-65	PFAM
low complexity region	1265	1275	N/A	INTRINSIC
A2M_recep	1311	1395	2.06e-27	SMART
low complexity region	1422	1437	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	A	T	15: 84,406,685	Y120*	probably null	Het
Abcb11	T	A	2: 69,329,376		probably benign	Het
Adgrl1	A	G	8: 83,923,004	N97S	possibly damaging	Het
Aldh1a2	A	G	9: 71,252,920	D76G	probably damaging	Het
Aldh3a1	A	G	11: 61,214,605	E179G	possibly damaging	Het
Ap1g1	A	G	8: 109,837,786	D324G	probably damaging	Het
Arfgap2	A	G	2: 91,265,366	T12A	probably benign	Het
Aurka	A	G	2: 172,366,960	L85P	probably benign	Het
Birc6	T	A	17: 74,618,429		probably benign	Het
Bmp7	A	T	2: 172,870,222	I403N	probably damaging	Het
Carns1	A	G	19: 4,170,916		probably benign	Het
Ccdc88c	G	A	12: 100,966,100		probably benign	Het
Ccl2	C	T	11: 82,036,958	A76V	probably damaging	Het
Clstn2	A	G	9: 97,582,562	I180T	probably damaging	Het
Col24a1	T	C	3: 145,545,286	L1680P	probably damaging	Het
Col4a6	C	A	X: 141,172,200	G1416C	probably damaging	Het
Ctnna2	T	G	6: 76,973,769	N573T	probably damaging	Het
Cts8	G	A	13: 61,250,901		probably benign	Het
Cxcl17	A	G	7: 25,400,329		probably benign	Het
Defb18	T	C	1: 18,236,621	H37R	possibly damaging	Het
Dis3l2	T	C	1: 86,854,408	I229T	probably benign	Het
Dysf	G	A	6: 84,152,351	S1474N	possibly damaging	Het
Elf1	T	C	14: 79,567,210	V105A	possibly damaging	Het
F13a1	T	C	13: 36,898,134	K532R	probably benign	Het
Fmn1	T	G	2: 113,582,118	S996A	probably damaging	Het
Focad	A	C	4: 88,336,161		probably benign	Het
Frmd4a	A	T	2: 4,590,622	E109D	probably damaging	Het
Frrs1	T	G	3: 116,878,387	S45A	possibly damaging	Het
Gm5422	T	A	10: 31,248,514		noncoding transcript	Het
Gm5866	T	C	5: 52,582,746		noncoding transcript	Het
Hmcn2	C	T	2: 31,360,896	T790M	probably damaging	Het
Iglon5	A	T	7: 43,480,613	Y42*	probably null	Het
Khdrbs2	C	T	1: 32,244,076	Q90*	probably null	Het
Krt74	T	C	15: 101,762,195		noncoding transcript	Het
Lamc2	T	A	1: 153,124,251	M1121L	probably benign	Het
Lrig1	A	G	6: 94,605,817	L1073P	probably benign	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Man2c1	C	A	9: 57,140,377		probably benign	Het
Megf10	G	A	18: 57,283,862	D768N	probably benign	Het
Mycbp2	T	C	14: 103,133,788	N4108S	possibly damaging	Het
Nid1	A	G	13: 13,476,418		probably benign	Het
Nnt	A	G	13: 119,396,952	V59A	probably damaging	Het
Nsd1	G	A	13: 55,246,673	V696I	probably benign	Het
Olfr99	T	C	17: 37,279,854	T189A	probably benign	Het
Pag1	G	A	3: 9,699,628	T155M	probably benign	Het
Pgam5	T	C	5: 110,265,593	H176R	probably damaging	Het
Pid1	T	C	1: 84,038,197	D149G	probably damaging	Het
Pkp3	G	A	7: 141,082,346	M1I	probably null	Het
Pld2	C	T	11: 70,544,123		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ptprs	T	C	17: 56,428,978	T152A	possibly damaging	Het
Rab9b	T	A	X: 136,861,449	E67D	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rnf214	T	C	9: 45,866,634	M625V	possibly damaging	Het
Rwdd2a	A	C	9: 86,574,161	N130T	possibly damaging	Het
Scn9a	T	C	2: 66,483,648	N1909D	probably benign	Het
Sept10	A	T	10: 59,176,887	M303K	probably damaging	Het
Sez6l2	A	G	7: 126,959,203	E339G	probably damaging	Het
Sf3b1	C	A	1: 54,999,991		probably benign	Het
Ska3	C	T	14: 57,810,077	V334I	probably benign	Het
Srebf2	A	G	15: 82,182,108	K579R	probably benign	Het
St18	A	T	1: 6,844,329	K799I	probably damaging	Het
Strada	C	T	11: 106,164,822	R333Q	probably damaging	Het
Stradb	A	T	1: 58,985,385	I64L	probably benign	Het
Sun1	A	G	5: 139,238,820		probably benign	Het
Tecta	T	C	9: 42,330,996	T2094A	probably damaging	Het
Tenm4	A	T	7: 96,694,880	R227W	probably damaging	Het
Tnk2	A	G	16: 32,679,822	D651G	probably damaging	Het
Trim43c	A	T	9: 88,847,757	D417V	probably damaging	Het
Tsc22d4	T	C	5: 137,759,233	L374P	possibly damaging	Het
Ttn	T	C	2: 76,771,367	T16872A	probably benign	Het
Ubr4	T	C	4: 139,452,700	V262A	possibly damaging	Het
Vmn2r60	A	T	7: 42,116,556	N29I	probably benign	Het
Xrn2	T	C	2: 147,061,287	V765A	probably benign	Het
Zbed4	C	T	15: 88,780,787	P353S	probably benign	Het
Zfp251	A	G	15: 76,853,636	I414T	possibly damaging	Het
Zfp426	A	T	9: 20,473,117		probably null	Het
Zwilch	A	T	9: 64,156,034	F286I	probably benign	Het

Other mutations in Cd109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cd109	APN	9	78616969	missense	probably damaging	1.00
IGL00465:Cd109	APN	9	78660934	nonsense	probably null
IGL00667:Cd109	APN	9	78684877	missense	probably damaging	0.99
IGL01432:Cd109	APN	9	78698123	missense	probably benign
IGL01795:Cd109	APN	9	78661765	splice site	probably benign
IGL02343:Cd109	APN	9	78688955	splice site	probably benign
IGL02450:Cd109	APN	9	78695850	missense	possibly damaging	0.83
IGL02699:Cd109	APN	9	78671989	splice site	probably benign
IGL02738:Cd109	APN	9	78691299	missense	probably damaging	1.00
IGL02797:Cd109	APN	9	78661713	missense	probably damaging	0.96
IGL03160:Cd109	APN	9	78661056	splice site	probably null
IGL03349:Cd109	APN	9	78636485	missense	probably benign	0.34
FR4589:Cd109	UTSW	9	78712529	critical splice acceptor site	probably benign
R0048:Cd109	UTSW	9	78680021	missense	possibly damaging	0.50
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0158:Cd109	UTSW	9	78688932	missense	possibly damaging	0.49
R0415:Cd109	UTSW	9	78712615	missense	probably benign	0.13
R0659:Cd109	UTSW	9	78680170	splice site	probably benign
R0709:Cd109	UTSW	9	78671978	missense	possibly damaging	0.93
R0840:Cd109	UTSW	9	78664330	missense	probably benign	0.04
R0909:Cd109	UTSW	9	78636473	missense	probably benign	0.01
R0945:Cd109	UTSW	9	78688941	missense	possibly damaging	0.51
R1344:Cd109	UTSW	9	78672550	critical splice acceptor site	probably null
R1471:Cd109	UTSW	9	78654587	missense	probably damaging	1.00
R1484:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R1570:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R1688:Cd109	UTSW	9	78705091	missense	probably benign	0.17
R1773:Cd109	UTSW	9	78703724	missense	probably benign	0.21
R1813:Cd109	UTSW	9	78617005	missense	probably benign	0.04
R2004:Cd109	UTSW	9	78703762	missense	probably benign	0.00
R2083:Cd109	UTSW	9	78667293	missense	probably damaging	1.00
R2483:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R2857:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2858:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2859:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2911:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2912:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2914:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2927:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3623:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R3713:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3760:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3762:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3771:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3916:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3917:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4117:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4260:Cd109	UTSW	9	78636463	missense	possibly damaging	0.67
R4387:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4389:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4526:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4527:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4528:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4700:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4708:Cd109	UTSW	9	78672589	missense	probably benign	0.00
R4723:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4750:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4751:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4754:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4755:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4984:Cd109	UTSW	9	78634677	critical splice donor site	probably null
R5259:Cd109	UTSW	9	78710152	missense	probably benign	0.30
R5353:Cd109	UTSW	9	78710239	missense	probably damaging	1.00
R5440:Cd109	UTSW	9	78680164	critical splice donor site	probably null
R5559:Cd109	UTSW	9	78660968	missense	probably benign	0.01
R5701:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R5995:Cd109	UTSW	9	78700279	missense	probably benign	0.01
R5997:Cd109	UTSW	9	78705062	missense	possibly damaging	0.93
R6103:Cd109	UTSW	9	78698314	splice site	probably null
R6174:Cd109	UTSW	9	78665546	critical splice donor site	probably null
R6410:Cd109	UTSW	9	78657516	missense	probably benign	0.01
R6529:Cd109	UTSW	9	78712625	missense	probably damaging	1.00
R6655:Cd109	UTSW	9	78684938	missense	probably benign	0.44
R6704:Cd109	UTSW	9	78680075	missense	probably benign	0.01
R6772:Cd109	UTSW	9	78680810	missense	possibly damaging	0.55
R6817:Cd109	UTSW	9	78714955	missense	probably benign	0.01
R6903:Cd109	UTSW	9	78636603	missense	probably damaging	0.97
R7294:Cd109	UTSW	9	78712635	missense	probably damaging	0.97
R7432:Cd109	UTSW	9	78714943	missense	possibly damaging	0.85
R7566:Cd109	UTSW	9	78680837	missense	probably damaging	1.00
R7767:Cd109	UTSW	9	78710159	missense	probably damaging	1.00
R7986:Cd109	UTSW	9	78688766	missense	possibly damaging	0.95
R8017:Cd109	UTSW	9	78707546	missense	possibly damaging	0.81
R8019:Cd109	UTSW	9	78707546	missense	possibly damaging	0.81
R8050:Cd109	UTSW	9	78664351	missense	probably benign	0.28
R8225:Cd109	UTSW	9	78661690	missense	probably damaging	0.99
R8269:Cd109	UTSW	9	78665682	missense	probably benign	0.06
R8479:Cd109	UTSW	9	78667346	nonsense	probably null
R8493:Cd109	UTSW	9	78657519	missense	probably benign	0.41
RF002:Cd109	UTSW	9	78712523	critical splice acceptor site	probably benign
RF002:Cd109	UTSW	9	78712528	critical splice acceptor site	probably benign
RF003:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
RF011:Cd109	UTSW	9	78712528	critical splice acceptor site	probably benign
RF013:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
RF047:Cd109	UTSW	9	78712527	critical splice acceptor site	probably benign
RF060:Cd109	UTSW	9	78712525	critical splice acceptor site	probably benign
Z1177:Cd109	UTSW	9	78691313	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCTTTAGTAGACGGGGACTAAGAAC -3'
(R):5'- AAAATGCCTGCCTTGATTCCC -3'

Sequencing Primer
(F):5'- GGGGACTAAGAACCATTCCTCTG -3'
(R):5'- GCCTTGATTCCCAAAGTCTTAGAAAC -3'

Posted On

2015-03-25