Incidental Mutation 'R3772:Nsd1'
ID273380
Institutional Source Beutler Lab
Gene Symbol Nsd1
Ensembl Gene ENSMUSG00000021488
Gene Namenuclear receptor-binding SET-domain protein 1
SynonymsKMT3B
MMRRC Submission 040748-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3772 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55209782-55318325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55246673 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 696 (V696I)
Ref Sequence ENSEMBL: ENSMUSP00000153677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224973]
Predicted Effect probably benign
Transcript: ENSMUST00000099490
AA Change: V799I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: V799I

DomainStartEndE-ValueType
low complexity region 177 187 N/A INTRINSIC
low complexity region 281 289 N/A INTRINSIC
PWWP 322 388 1.97e-3 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 980 1000 N/A INTRINSIC
low complexity region 1296 1309 N/A INTRINSIC
PHD 1546 1588 4.25e-8 SMART
PHD 1593 1640 3.79e-5 SMART
RING 1594 1639 1.08e-1 SMART
PHD 1641 1694 1.09e1 SMART
PHD 1710 1750 1.02e-10 SMART
PWWP 1755 1817 8.87e-29 SMART
AWS 1891 1942 3.02e-22 SMART
SET 1943 2066 1e-45 SMART
PostSET 2067 2083 3.99e-3 SMART
PHD 2121 2164 1.08e-9 SMART
low complexity region 2224 2237 N/A INTRINSIC
low complexity region 2276 2286 N/A INTRINSIC
low complexity region 2335 2356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224973
AA Change: V696I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adgrl1 A G 8: 83,923,004 N97S possibly damaging Het
Aldh1a2 A G 9: 71,252,920 D76G probably damaging Het
Aldh3a1 A G 11: 61,214,605 E179G possibly damaging Het
Ap1g1 A G 8: 109,837,786 D324G probably damaging Het
Arfgap2 A G 2: 91,265,366 T12A probably benign Het
Aurka A G 2: 172,366,960 L85P probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Bmp7 A T 2: 172,870,222 I403N probably damaging Het
Carns1 A G 19: 4,170,916 probably benign Het
Ccdc88c G A 12: 100,966,100 probably benign Het
Ccl2 C T 11: 82,036,958 A76V probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Col24a1 T C 3: 145,545,286 L1680P probably damaging Het
Col4a6 C A X: 141,172,200 G1416C probably damaging Het
Ctnna2 T G 6: 76,973,769 N573T probably damaging Het
Cts8 G A 13: 61,250,901 probably benign Het
Cxcl17 A G 7: 25,400,329 probably benign Het
Defb18 T C 1: 18,236,621 H37R possibly damaging Het
Dis3l2 T C 1: 86,854,408 I229T probably benign Het
Dysf G A 6: 84,152,351 S1474N possibly damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
F13a1 T C 13: 36,898,134 K532R probably benign Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Focad A C 4: 88,336,161 probably benign Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Frrs1 T G 3: 116,878,387 S45A possibly damaging Het
Gm5422 T A 10: 31,248,514 noncoding transcript Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Iglon5 A T 7: 43,480,613 Y42* probably null Het
Khdrbs2 C T 1: 32,244,076 Q90* probably null Het
Krt74 T C 15: 101,762,195 noncoding transcript Het
Lamc2 T A 1: 153,124,251 M1121L probably benign Het
Lrig1 A G 6: 94,605,817 L1073P probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Megf10 G A 18: 57,283,862 D768N probably benign Het
Mycbp2 T C 14: 103,133,788 N4108S possibly damaging Het
Nid1 A G 13: 13,476,418 probably benign Het
Nnt A G 13: 119,396,952 V59A probably damaging Het
Olfr99 T C 17: 37,279,854 T189A probably benign Het
Pag1 G A 3: 9,699,628 T155M probably benign Het
Pgam5 T C 5: 110,265,593 H176R probably damaging Het
Pid1 T C 1: 84,038,197 D149G probably damaging Het
Pkp3 G A 7: 141,082,346 M1I probably null Het
Pld2 C T 11: 70,544,123 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rab9b T A X: 136,861,449 E67D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf214 T C 9: 45,866,634 M625V possibly damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Sept10 A T 10: 59,176,887 M303K probably damaging Het
Sez6l2 A G 7: 126,959,203 E339G probably damaging Het
Sf3b1 C A 1: 54,999,991 probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
St18 A T 1: 6,844,329 K799I probably damaging Het
Strada C T 11: 106,164,822 R333Q probably damaging Het
Stradb A T 1: 58,985,385 I64L probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tnk2 A G 16: 32,679,822 D651G probably damaging Het
Trim43c A T 9: 88,847,757 D417V probably damaging Het
Tsc22d4 T C 5: 137,759,233 L374P possibly damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ubr4 T C 4: 139,452,700 V262A possibly damaging Het
Vmn2r60 A T 7: 42,116,556 N29I probably benign Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 C T 15: 88,780,787 P353S probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zwilch A T 9: 64,156,034 F286I probably benign Het
Other mutations in Nsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Nsd1 APN 13 55238735 missense probably damaging 1.00
IGL01060:Nsd1 APN 13 55263429 missense probably damaging 1.00
IGL01125:Nsd1 APN 13 55245617 missense probably damaging 1.00
IGL01746:Nsd1 APN 13 55276515 splice site probably null
IGL02437:Nsd1 APN 13 55313441 missense probably damaging 1.00
IGL02530:Nsd1 APN 13 55302833 splice site probably benign
IGL02557:Nsd1 APN 13 55312448 missense probably damaging 1.00
IGL02572:Nsd1 APN 13 55296130 missense probably damaging 1.00
IGL02665:Nsd1 APN 13 55296183 missense probably damaging 1.00
IGL02870:Nsd1 APN 13 55313603 missense probably benign 0.06
IGL03181:Nsd1 APN 13 55247045 missense probably damaging 1.00
Amanuensis UTSW 13 55261626 nonsense probably null
scribe UTSW 13 55291236 missense probably damaging 1.00
PIT4480001:Nsd1 UTSW 13 55213918 missense probably benign 0.11
R0316:Nsd1 UTSW 13 55213771 missense probably damaging 0.98
R0519:Nsd1 UTSW 13 55312835 missense probably benign 0.04
R0542:Nsd1 UTSW 13 55260458 missense possibly damaging 0.93
R0563:Nsd1 UTSW 13 55246578 missense possibly damaging 0.48
R0652:Nsd1 UTSW 13 55247586 missense possibly damaging 0.92
R0906:Nsd1 UTSW 13 55277590 missense probably benign 0.30
R1560:Nsd1 UTSW 13 55246720 nonsense probably null
R1572:Nsd1 UTSW 13 55246969 missense probably damaging 0.98
R1693:Nsd1 UTSW 13 55247261 missense probably benign
R1697:Nsd1 UTSW 13 55214059 critical splice acceptor site probably null
R1720:Nsd1 UTSW 13 55246898 missense probably damaging 0.98
R1829:Nsd1 UTSW 13 55246369 missense probably damaging 1.00
R1834:Nsd1 UTSW 13 55313351 missense possibly damaging 0.52
R1842:Nsd1 UTSW 13 55246445 missense probably damaging 1.00
R1880:Nsd1 UTSW 13 55213793 missense probably damaging 0.99
R2022:Nsd1 UTSW 13 55213279 missense probably damaging 0.99
R2075:Nsd1 UTSW 13 55310500 missense possibly damaging 0.74
R2143:Nsd1 UTSW 13 55260397 missense probably damaging 1.00
R2151:Nsd1 UTSW 13 55291236 missense probably damaging 1.00
R2316:Nsd1 UTSW 13 55233966 missense probably damaging 1.00
R2359:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2361:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2656:Nsd1 UTSW 13 55246868 missense probably damaging 1.00
R2849:Nsd1 UTSW 13 55213692 missense probably damaging 0.99
R3237:Nsd1 UTSW 13 55312888 missense possibly damaging 0.92
R3773:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3849:Nsd1 UTSW 13 55246691 missense probably benign 0.00
R3951:Nsd1 UTSW 13 55268454 missense probably benign 0.05
R4036:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R4073:Nsd1 UTSW 13 55247728 missense probably benign 0.28
R4080:Nsd1 UTSW 13 55301809 missense probably damaging 0.96
R4226:Nsd1 UTSW 13 55260401 missense probably damaging 1.00
R4485:Nsd1 UTSW 13 55245621 missense probably benign
R4703:Nsd1 UTSW 13 55214063 missense probably damaging 1.00
R4853:Nsd1 UTSW 13 55268504 missense probably benign 0.30
R4915:Nsd1 UTSW 13 55247868 missense possibly damaging 0.65
R4915:Nsd1 UTSW 13 55276528 missense probably benign 0.00
R5264:Nsd1 UTSW 13 55247346 missense possibly damaging 0.49
R5348:Nsd1 UTSW 13 55312334 missense probably benign 0.00
R5473:Nsd1 UTSW 13 55247772 missense probably damaging 1.00
R5498:Nsd1 UTSW 13 55213302 nonsense probably null
R5503:Nsd1 UTSW 13 55245939 missense probably damaging 1.00
R5511:Nsd1 UTSW 13 55312730 missense probably benign 0.00
R5683:Nsd1 UTSW 13 55246148 missense probably benign 0.00
R5778:Nsd1 UTSW 13 55306979 missense probably damaging 1.00
R5793:Nsd1 UTSW 13 55248006 missense probably benign
R5922:Nsd1 UTSW 13 55247475 missense probably benign 0.01
R5956:Nsd1 UTSW 13 55263404 missense probably damaging 1.00
R6053:Nsd1 UTSW 13 55293609 missense probably damaging 1.00
R6141:Nsd1 UTSW 13 55291284 missense probably damaging 1.00
R6158:Nsd1 UTSW 13 55245621 missense probably benign
R6224:Nsd1 UTSW 13 55313132 missense possibly damaging 0.85
R6396:Nsd1 UTSW 13 55238789 missense probably damaging 1.00
R6598:Nsd1 UTSW 13 55293702 missense possibly damaging 0.94
R7170:Nsd1 UTSW 13 55261626 nonsense probably null
R7205:Nsd1 UTSW 13 55246470 missense probably damaging 1.00
R7215:Nsd1 UTSW 13 55247641 missense probably benign 0.00
R7337:Nsd1 UTSW 13 55246209 missense probably damaging 1.00
R7432:Nsd1 UTSW 13 55213374 missense probably benign
R7638:Nsd1 UTSW 13 55312328 missense probably benign 0.01
R7647:Nsd1 UTSW 13 55299835 missense probably damaging 0.96
R7658:Nsd1 UTSW 13 55277639 missense probably damaging 1.00
R7884:Nsd1 UTSW 13 55313255 missense probably damaging 0.99
R8032:Nsd1 UTSW 13 55310383 missense probably damaging 1.00
R8113:Nsd1 UTSW 13 55245621 missense probably benign
R8152:Nsd1 UTSW 13 55310367 missense possibly damaging 0.49
R8183:Nsd1 UTSW 13 55312373 missense probably damaging 1.00
R8432:Nsd1 UTSW 13 55247703 missense possibly damaging 0.91
R8469:Nsd1 UTSW 13 55277553 missense possibly damaging 0.76
Z1088:Nsd1 UTSW 13 55213848 missense possibly damaging 0.83
Z1176:Nsd1 UTSW 13 55245525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGAAACTGCTGAGTTG -3'
(R):5'- AGAACGTGCTTCACCACTG -3'

Sequencing Primer
(F):5'- GAGTTGTCTCAGGTCAATCTTTC -3'
(R):5'- ACTGCTGTTTCTATGTCACTAGAATC -3'
Posted On2015-03-25