Mutagenetix > Incidental Mutations

Incidental Mutation 'R3772:Ptprs'

273392

Institutional Source

Beutler Lab

Gene Symbol

Ptprs

Ensembl Gene

ENSMUSG00000013236

Gene Name

protein tyrosine phosphatase, receptor type, S

Synonyms

Ptpt9, PTP-NU3, RPTPsigma, PTPsigma

MMRRC Submission

040748-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3772 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56412426-56476483 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56428978 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 152 (T152A)

Ref Sequence

ENSEMBL: ENSMUSP00000153398 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067538] [ENSMUST00000086828] [ENSMUST00000223642] [ENSMUST00000223859] [ENSMUST00000225456]

Predicted Effect

probably benign
Transcript: ENSMUST00000067538
AA Change: T664A

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000064048
Gene: ENSMUSG00000013236
AA Change: T664A

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
IGc2	45	114	3.38e-10	SMART
IGc2	147	214	2.4e-15	SMART
IGc2	244	305	8.26e-5	SMART
FN3	319	398	2.8e-14	SMART
FN3	414	497	3.24e-10	SMART
FN3	512	590	3.17e-13	SMART
FN3	605	692	9.69e-9	SMART
FN3	707	796	2.42e-9	SMART
FN3	811	890	2.22e0	SMART
FN3	905	995	8.31e-8	SMART
FN3	1009	1085	3.22e-5	SMART
low complexity region	1164	1177	N/A	INTRINSIC
transmembrane domain	1259	1281	N/A	INTRINSIC
PTPc	1351	1609	1.54e-136	SMART
PTPc	1638	1900	3.12e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000086828

SMART Domains

Protein: ENSMUSP00000084038
Gene: ENSMUSG00000013236

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
IGc2	45	114	3.38e-10	SMART
IGc2	147	214	2.4e-15	SMART
IGc2	244	305	8.26e-5	SMART
FN3	319	398	2.8e-14	SMART
FN3	414	497	3.24e-10	SMART
FN3	512	590	3.17e-13	SMART
FN3	603	679	2.54e-3	SMART
low complexity region	758	771	N/A	INTRINSIC
transmembrane domain	853	875	N/A	INTRINSIC
PTPc	945	1203	1.54e-136	SMART
PTPc	1232	1494	3.12e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143018

Predicted Effect

probably benign
Transcript: ENSMUST00000223642

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223671

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223706

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223783

Predicted Effect

probably benign
Transcript: ENSMUST00000223859

Predicted Effect

probably benign
Transcript: ENSMUST00000224777

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225104

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225456
AA Change: T152A

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225785

Meta Mutation Damage Score

0.0650

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Almost half of null homozygotes die in the first day of life. Embryos are characterized by decreased brain size including small pituitary glands and small olfactory bulbs. Adult mice are small, lack estrus, have decreased litter sizes and have impairedolfaction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	A	T	15: 84,406,685	Y120*	probably null	Het
Abcb11	T	A	2: 69,329,376		probably benign	Het
Adgrl1	A	G	8: 83,923,004	N97S	possibly damaging	Het
Aldh1a2	A	G	9: 71,252,920	D76G	probably damaging	Het
Aldh3a1	A	G	11: 61,214,605	E179G	possibly damaging	Het
Ap1g1	A	G	8: 109,837,786	D324G	probably damaging	Het
Arfgap2	A	G	2: 91,265,366	T12A	probably benign	Het
Aurka	A	G	2: 172,366,960	L85P	probably benign	Het
Birc6	T	A	17: 74,618,429		probably benign	Het
Bmp7	A	T	2: 172,870,222	I403N	probably damaging	Het
Carns1	A	G	19: 4,170,916		probably benign	Het
Ccdc88c	G	A	12: 100,966,100		probably benign	Het
Ccl2	C	T	11: 82,036,958	A76V	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Clstn2	A	G	9: 97,582,562	I180T	probably damaging	Het
Col24a1	T	C	3: 145,545,286	L1680P	probably damaging	Het
Col4a6	C	A	X: 141,172,200	G1416C	probably damaging	Het
Ctnna2	T	G	6: 76,973,769	N573T	probably damaging	Het
Cts8	G	A	13: 61,250,901		probably benign	Het
Cxcl17	A	G	7: 25,400,329		probably benign	Het
Defb18	T	C	1: 18,236,621	H37R	possibly damaging	Het
Dis3l2	T	C	1: 86,854,408	I229T	probably benign	Het
Dysf	G	A	6: 84,152,351	S1474N	possibly damaging	Het
Elf1	T	C	14: 79,567,210	V105A	possibly damaging	Het
F13a1	T	C	13: 36,898,134	K532R	probably benign	Het
Fmn1	T	G	2: 113,582,118	S996A	probably damaging	Het
Focad	A	C	4: 88,336,161		probably benign	Het
Frmd4a	A	T	2: 4,590,622	E109D	probably damaging	Het
Frrs1	T	G	3: 116,878,387	S45A	possibly damaging	Het
Gm5422	T	A	10: 31,248,514		noncoding transcript	Het
Gm5866	T	C	5: 52,582,746		noncoding transcript	Het
Hmcn2	C	T	2: 31,360,896	T790M	probably damaging	Het
Iglon5	A	T	7: 43,480,613	Y42*	probably null	Het
Khdrbs2	C	T	1: 32,244,076	Q90*	probably null	Het
Krt74	T	C	15: 101,762,195		noncoding transcript	Het
Lamc2	T	A	1: 153,124,251	M1121L	probably benign	Het
Lrig1	A	G	6: 94,605,817	L1073P	probably benign	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Man2c1	C	A	9: 57,140,377		probably benign	Het
Megf10	G	A	18: 57,283,862	D768N	probably benign	Het
Mycbp2	T	C	14: 103,133,788	N4108S	possibly damaging	Het
Nid1	A	G	13: 13,476,418		probably benign	Het
Nnt	A	G	13: 119,396,952	V59A	probably damaging	Het
Nsd1	G	A	13: 55,246,673	V696I	probably benign	Het
Olfr99	T	C	17: 37,279,854	T189A	probably benign	Het
Pag1	G	A	3: 9,699,628	T155M	probably benign	Het
Pgam5	T	C	5: 110,265,593	H176R	probably damaging	Het
Pid1	T	C	1: 84,038,197	D149G	probably damaging	Het
Pkp3	G	A	7: 141,082,346	M1I	probably null	Het
Pld2	C	T	11: 70,544,123		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rab9b	T	A	X: 136,861,449	E67D	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rnf214	T	C	9: 45,866,634	M625V	possibly damaging	Het
Rwdd2a	A	C	9: 86,574,161	N130T	possibly damaging	Het
Scn9a	T	C	2: 66,483,648	N1909D	probably benign	Het
Sept10	A	T	10: 59,176,887	M303K	probably damaging	Het
Sez6l2	A	G	7: 126,959,203	E339G	probably damaging	Het
Sf3b1	C	A	1: 54,999,991		probably benign	Het
Ska3	C	T	14: 57,810,077	V334I	probably benign	Het
Srebf2	A	G	15: 82,182,108	K579R	probably benign	Het
St18	A	T	1: 6,844,329	K799I	probably damaging	Het
Strada	C	T	11: 106,164,822	R333Q	probably damaging	Het
Stradb	A	T	1: 58,985,385	I64L	probably benign	Het
Sun1	A	G	5: 139,238,820		probably benign	Het
Tecta	T	C	9: 42,330,996	T2094A	probably damaging	Het
Tenm4	A	T	7: 96,694,880	R227W	probably damaging	Het
Tnk2	A	G	16: 32,679,822	D651G	probably damaging	Het
Trim43c	A	T	9: 88,847,757	D417V	probably damaging	Het
Tsc22d4	T	C	5: 137,759,233	L374P	possibly damaging	Het
Ttn	T	C	2: 76,771,367	T16872A	probably benign	Het
Ubr4	T	C	4: 139,452,700	V262A	possibly damaging	Het
Vmn2r60	A	T	7: 42,116,556	N29I	probably benign	Het
Xrn2	T	C	2: 147,061,287	V765A	probably benign	Het
Zbed4	C	T	15: 88,780,787	P353S	probably benign	Het
Zfp251	A	G	15: 76,853,636	I414T	possibly damaging	Het
Zfp426	A	T	9: 20,473,117		probably null	Het
Zwilch	A	T	9: 64,156,034	F286I	probably benign	Het

Other mutations in Ptprs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Ptprs	APN	17	56458243	missense	probably damaging	0.99
IGL01388:Ptprs	APN	17	56421261	missense	probably damaging	1.00
IGL01568:Ptprs	APN	17	56413958	missense	probably damaging	1.00
IGL01781:Ptprs	APN	17	56435676	missense	probably damaging	1.00
IGL02499:Ptprs	APN	17	56437884	missense	probably damaging	1.00
IGL02576:Ptprs	APN	17	56414958	missense	probably damaging	1.00
IGL02736:Ptprs	APN	17	56458248	missense	possibly damaging	0.88
IGL02871:Ptprs	APN	17	56447443	missense	probably damaging	1.00
IGL02946:Ptprs	APN	17	56424032	missense	probably benign
IGL03061:Ptprs	APN	17	56418830	missense	probably damaging	0.96
IGL03347:Ptprs	APN	17	56435972	missense	probably benign	0.07
IGL03351:Ptprs	APN	17	56437943	missense	probably damaging	1.00
P0019:Ptprs	UTSW	17	56447474	splice site	probably benign
PIT4434001:Ptprs	UTSW	17	56454984	missense	probably null	0.02
PIT4520001:Ptprs	UTSW	17	56414980	missense	probably damaging	1.00
R0240:Ptprs	UTSW	17	56436087	splice site	probably null
R0240:Ptprs	UTSW	17	56436087	splice site	probably null
R0504:Ptprs	UTSW	17	56454220	missense	possibly damaging	0.60
R0518:Ptprs	UTSW	17	56419621	critical splice donor site	probably null
R0539:Ptprs	UTSW	17	56458255	missense	probably damaging	0.97
R0620:Ptprs	UTSW	17	56429103	missense	possibly damaging	0.93
R0683:Ptprs	UTSW	17	56414086	missense	probably damaging	1.00
R1147:Ptprs	UTSW	17	56423504	missense	probably damaging	1.00
R1147:Ptprs	UTSW	17	56423504	missense	probably damaging	1.00
R1474:Ptprs	UTSW	17	56424128	missense	probably damaging	0.98
R1502:Ptprs	UTSW	17	56437992	missense	probably benign	0.00
R1817:Ptprs	UTSW	17	56419527	missense	probably damaging	1.00
R1844:Ptprs	UTSW	17	56434510	missense	probably damaging	1.00
R2077:Ptprs	UTSW	17	56434990	missense	probably null	0.26
R2086:Ptprs	UTSW	17	56454984	missense	probably null	0.02
R2149:Ptprs	UTSW	17	56417706	missense	probably damaging	1.00
R3618:Ptprs	UTSW	17	56428965	missense	probably benign	0.25
R3722:Ptprs	UTSW	17	56417485	missense	probably damaging	1.00
R3771:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R3773:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R4032:Ptprs	UTSW	17	56413386	missense	probably damaging	1.00
R4326:Ptprs	UTSW	17	56447468	missense	possibly damaging	0.83
R4327:Ptprs	UTSW	17	56447468	missense	possibly damaging	0.83
R4480:Ptprs	UTSW	17	56426404	missense	possibly damaging	0.79
R4505:Ptprs	UTSW	17	56451678	missense	possibly damaging	0.57
R4507:Ptprs	UTSW	17	56419014	missense	probably damaging	1.00
R4588:Ptprs	UTSW	17	56425534	missense	probably damaging	1.00
R4662:Ptprs	UTSW	17	56417666	missense	probably damaging	1.00
R4708:Ptprs	UTSW	17	56428067	missense	probably damaging	1.00
R5016:Ptprs	UTSW	17	56419070	missense	probably damaging	1.00
R5416:Ptprs	UTSW	17	56435724	missense	probably damaging	1.00
R5447:Ptprs	UTSW	17	56429128	missense	possibly damaging	0.50
R6041:Ptprs	UTSW	17	56419080	missense	probably benign	0.00
R6329:Ptprs	UTSW	17	56417427	nonsense	probably null
R6377:Ptprs	UTSW	17	56418935	missense	probably damaging	1.00
R6605:Ptprs	UTSW	17	56422195	missense	probably damaging	1.00
R6749:Ptprs	UTSW	17	56437884	missense	probably damaging	1.00
R7113:Ptprs	UTSW	17	56451697	missense	probably benign	0.40
R7114:Ptprs	UTSW	17	56451697	missense	probably benign	0.40
R7133:Ptprs	UTSW	17	56417429	missense	probably damaging	1.00
R7220:Ptprs	UTSW	17	56418988	missense	probably benign	0.29
R7423:Ptprs	UTSW	17	56414793	missense	probably damaging	1.00
R7440:Ptprs	UTSW	17	56424256	missense	possibly damaging	0.75
R7457:Ptprs	UTSW	17	56419502	missense	probably damaging	0.99
R7574:Ptprs	UTSW	17	56423538	missense	probably benign	0.00
R7851:Ptprs	UTSW	17	56425482	missense	probably benign
R7903:Ptprs	UTSW	17	56424960	nonsense	probably null
R8013:Ptprs	UTSW	17	56435994	missense	probably damaging	1.00
R8014:Ptprs	UTSW	17	56435994	missense	probably damaging	1.00
R8094:Ptprs	UTSW	17	56428947	missense	probably benign	0.01
R8112:Ptprs	UTSW	17	56434532	nonsense	probably null
R8181:Ptprs	UTSW	17	56429064	missense	probably damaging	1.00
R8511:Ptprs	UTSW	17	56447440	missense	probably damaging	1.00
RF014:Ptprs	UTSW	17	56416935	missense	probably damaging	1.00
X0028:Ptprs	UTSW	17	56437831	missense	probably damaging	1.00
Z1176:Ptprs	UTSW	17	56417050	missense	possibly damaging	0.82
Z1176:Ptprs	UTSW	17	56422211	nonsense	probably null
Z1176:Ptprs	UTSW	17	56434468	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- CAGAGCACCTAAGACTCAGGAG -3'
(R):5'- CCCCTCAAGACGTTAAGTGC -3'

Sequencing Primer
(F):5'- AACTTCGAGGCCAGCTTG -3'
(R):5'- ACGTTAAGTGCACCAGCTTG -3'

Posted On

2015-03-25