Incidental Mutation 'R3773:Suco'
ID273400
Institutional Source Beutler Lab
Gene Symbol Suco
Ensembl Gene ENSMUSG00000040297
Gene NameSUN domain containing ossification factor
SynonymsAI848100, Opt, osteopotentia
MMRRC Submission 040749-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock #R3773 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location161816114-161876682 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 161843996 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048377]
Predicted Effect probably null
Transcript: ENSMUST00000048377
SMART Domains Protein: ENSMUSP00000044815
Gene: ENSMUSG00000040297

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 32 41 N/A INTRINSIC
low complexity region 117 145 N/A INTRINSIC
low complexity region 208 224 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
Pfam:Sad1_UNC 325 455 9e-43 PFAM
low complexity region 665 683 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
coiled coil region 933 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1105 1119 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194388
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation in this gene display background strain-dependent neonatal and postnatal lethality, and impaired osteoblast differentiation resulting in impaired bone formation, brittle bones, and impaired fracture repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,876,262 M1T probably null Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
A2ml1 T A 6: 128,555,083 K899N probably benign Het
Adgrv1 G A 13: 81,499,043 S3126L probably damaging Het
Apba3 C A 10: 81,272,609 probably null Het
Apobec4 G T 1: 152,756,805 A195S probably benign Het
Asap3 C T 4: 136,227,575 T72I probably benign Het
BC067074 A G 13: 113,318,209 E263G probably benign Het
Cand2 T A 6: 115,785,217 H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Csgalnact2 T C 6: 118,126,219 K19E probably benign Het
Cyp17a1 T G 19: 46,669,723 K250T probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dgcr8 T C 16: 18,256,775 D712G probably damaging Het
Dsg2 T C 18: 20,591,862 W442R probably damaging Het
Elavl2 C T 4: 91,264,088 G131R probably damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Ercc6l2 A G 13: 63,841,450 D270G probably damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Fry A T 5: 150,398,198 R999S probably damaging Het
Gak G A 5: 108,582,672 T956I probably benign Het
Gm6614 T C 6: 141,972,335 K605R probably benign Het
Gm9008 C T 6: 76,496,959 V225I probably benign Het
Gps2 T C 11: 69,916,101 F21L probably damaging Het
Grhl3 C T 4: 135,555,847 W303* probably null Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Matk T A 10: 81,258,297 L21Q probably benign Het
Mthfr T C 4: 148,044,450 V160A probably benign Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Olfr1497 T A 19: 13,795,204 M136L probably benign Het
Olfr345 A T 2: 36,640,321 Y94F probably benign Het
Olfr57 G A 10: 79,035,180 C128Y possibly damaging Het
Olfr90 G T 17: 37,086,065 Y33* probably null Het
Pcdhb15 T A 18: 37,475,890 V725D probably benign Het
Pes1 A G 11: 3,975,548 Y221C probably damaging Het
Prkd3 T C 17: 78,959,106 I603V possibly damaging Het
Ptpn13 A G 5: 103,477,121 E97G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rims1 T C 1: 22,421,810 D842G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rngtt T C 4: 33,330,889 I164T probably damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Stxbp5 G A 10: 9,768,927 T960I probably damaging Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tmem131l A G 3: 83,898,586 S1517P probably damaging Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Tsg101 T C 7: 46,889,615 *254W probably null Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Upb1 T A 10: 75,439,838 probably null Het
Vmn1r32 T A 6: 66,553,367 I142F probably benign Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 T C 15: 88,780,847 S373P probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp423 A T 8: 87,780,512 L1047Q probably benign Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Suco
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Suco APN 1 161834120 missense probably damaging 1.00
IGL01688:Suco APN 1 161863911 splice site probably null
IGL01794:Suco APN 1 161827725 missense probably benign 0.01
IGL01891:Suco APN 1 161838802 missense probably damaging 1.00
IGL02028:Suco APN 1 161856859 missense possibly damaging 0.95
IGL02102:Suco APN 1 161827705 missense probably damaging 1.00
IGL02351:Suco APN 1 161818626 missense probably benign 0.35
IGL02358:Suco APN 1 161818626 missense probably benign 0.35
IGL02392:Suco APN 1 161834567 missense probably benign 0.11
IGL02638:Suco APN 1 161827687 missense probably damaging 1.00
IGL02650:Suco APN 1 161848753 splice site probably benign
IGL03106:Suco APN 1 161834480 missense possibly damaging 0.91
IGL03189:Suco APN 1 161857337 unclassified probably benign
IGL03328:Suco APN 1 161820421 missense probably damaging 0.99
girth UTSW 1 161828240 missense possibly damaging 0.86
pleasingly UTSW 1 161834408 missense possibly damaging 0.65
3-1:Suco UTSW 1 161822031 intron probably benign
H8562:Suco UTSW 1 161852851 missense probably damaging 1.00
H8786:Suco UTSW 1 161852851 missense probably damaging 1.00
R0023:Suco UTSW 1 161845585 splice site probably null
R0023:Suco UTSW 1 161845585 splice site probably null
R0179:Suco UTSW 1 161876305 splice site probably benign
R0299:Suco UTSW 1 161853810 missense probably benign
R0418:Suco UTSW 1 161834850 missense probably benign 0.11
R0481:Suco UTSW 1 161862313 unclassified probably benign
R0610:Suco UTSW 1 161859503 missense probably benign
R0610:Suco UTSW 1 161864032 splice site probably benign
R0634:Suco UTSW 1 161838804 missense possibly damaging 0.77
R0645:Suco UTSW 1 161834114 missense probably damaging 1.00
R1276:Suco UTSW 1 161857456 missense probably benign 0.10
R1720:Suco UTSW 1 161834054 missense probably damaging 1.00
R1739:Suco UTSW 1 161827655 critical splice donor site probably null
R1763:Suco UTSW 1 161834949 missense possibly damaging 0.80
R1835:Suco UTSW 1 161859500 nonsense probably null
R1988:Suco UTSW 1 161818811 critical splice acceptor site probably null
R2939:Suco UTSW 1 161848651 missense probably damaging 1.00
R3882:Suco UTSW 1 161834744 missense probably benign 0.33
R4193:Suco UTSW 1 161863959 missense probably benign 0.32
R4367:Suco UTSW 1 161847230 missense probably damaging 1.00
R4397:Suco UTSW 1 161844852 missense probably damaging 1.00
R4846:Suco UTSW 1 161834408 missense possibly damaging 0.65
R4851:Suco UTSW 1 161834192 missense probably damaging 1.00
R5224:Suco UTSW 1 161834705 missense probably benign 0.06
R5329:Suco UTSW 1 161833430 missense probably damaging 0.99
R6133:Suco UTSW 1 161835183 nonsense probably null
R6632:Suco UTSW 1 161828240 missense possibly damaging 0.86
R6643:Suco UTSW 1 161859432 missense possibly damaging 0.71
R7378:Suco UTSW 1 161862211 missense possibly damaging 0.76
R7405:Suco UTSW 1 161828214 missense possibly damaging 0.65
R7509:Suco UTSW 1 161845334 missense probably damaging 1.00
R7838:Suco UTSW 1 161829321 missense probably benign 0.07
R7867:Suco UTSW 1 161837796 missense possibly damaging 0.77
R7895:Suco UTSW 1 161845368 splice site probably null
R8440:Suco UTSW 1 161852338 missense probably damaging 1.00
R8453:Suco UTSW 1 161823017 intron probably benign
R8781:Suco UTSW 1 161818382 missense probably damaging 1.00
R8798:Suco UTSW 1 161820435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATCTGATTCCATCCCATGC -3'
(R):5'- ACCTGTAAGGCTTCTGACCCTC -3'

Sequencing Primer
(F):5'- GATTCCATCCCATGCTTAGATTTC -3'
(R):5'- GGCTTCTGACCCTCTTTATGTAAATG -3'
Posted On2015-03-25