Incidental Mutation 'R3773:Scn9a'
ID 273406
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Name sodium channel, voltage-gated, type IX, alpha
Synonyms PN1
MMRRC Submission 040749-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3773 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 66310424-66465306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66313992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1909 (N1909D)
Ref Sequence ENSEMBL: ENSMUSP00000126528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
AlphaFold Q62205
Predicted Effect probably benign
Transcript: ENSMUST00000100063
AA Change: N1900D

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: N1900D

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100064
AA Change: N1909D

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: N1909D

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112354
AA Change: N1898D

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: N1898D

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152740
Predicted Effect probably benign
Transcript: ENSMUST00000164384
AA Change: N1909D

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: N1909D

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169900
AA Change: N1898D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: N1898D

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,532,046 (GRCm39) K899N probably benign Het
Acsbg3 T C 17: 57,183,262 (GRCm39) M1T probably null Het
Adgrv1 G A 13: 81,647,162 (GRCm39) S3126L probably damaging Het
Apba3 C A 10: 81,108,443 (GRCm39) probably null Het
Apobec4 G T 1: 152,632,556 (GRCm39) A195S probably benign Het
Asap3 C T 4: 135,954,886 (GRCm39) T72I probably benign Het
Cand2 T A 6: 115,762,178 (GRCm39) H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Chd1 A G 17: 17,594,913 (GRCm39) D16G probably damaging Het
Csgalnact2 T C 6: 118,103,180 (GRCm39) K19E probably benign Het
Cspg4b A G 13: 113,454,743 (GRCm39) E263G probably benign Het
Cyp17a1 T G 19: 46,658,162 (GRCm39) K250T probably damaging Het
Ddx41 G A 13: 55,682,293 (GRCm39) R205W possibly damaging Het
Dgcr8 T C 16: 18,074,639 (GRCm39) D712G probably damaging Het
Dsg2 T C 18: 20,724,919 (GRCm39) W442R probably damaging Het
Elavl2 C T 4: 91,152,325 (GRCm39) G131R probably damaging Het
Elf1 T C 14: 79,804,650 (GRCm39) V105A possibly damaging Het
Ercc6l2 A G 13: 63,989,264 (GRCm39) D270G probably damaging Het
Fmn1 T G 2: 113,412,463 (GRCm39) S996A probably damaging Het
Frmd4a A T 2: 4,595,433 (GRCm39) E109D probably damaging Het
Fry A T 5: 150,321,663 (GRCm39) R999S probably damaging Het
Gak G A 5: 108,730,538 (GRCm39) T956I probably benign Het
Gps2 T C 11: 69,806,927 (GRCm39) F21L probably damaging Het
Grhl3 C T 4: 135,283,158 (GRCm39) W303* probably null Het
Hmcn2 C T 2: 31,250,908 (GRCm39) T790M probably damaging Het
Lrp5 G A 19: 3,662,330 (GRCm39) R173C probably damaging Het
Matk T A 10: 81,094,131 (GRCm39) L21Q probably benign Het
Mthfr T C 4: 148,128,907 (GRCm39) V160A probably benign Het
Nhlrc4 T A 17: 26,162,367 (GRCm39) K127* probably null Het
Nsd1 G A 13: 55,394,486 (GRCm39) V696I probably benign Het
Nup210l T G 3: 90,027,201 (GRCm39) Y194* probably null Het
Or1j16 A T 2: 36,530,333 (GRCm39) Y94F probably benign Het
Or2h2 G T 17: 37,396,957 (GRCm39) Y33* probably null Het
Or7a41 G A 10: 78,871,014 (GRCm39) C128Y possibly damaging Het
Or9q2 T A 19: 13,772,568 (GRCm39) M136L probably benign Het
Pcdhb15 T A 18: 37,608,943 (GRCm39) V725D probably benign Het
Pes1 A G 11: 3,925,548 (GRCm39) Y221C probably damaging Het
Prkd3 T C 17: 79,266,535 (GRCm39) I603V possibly damaging Het
Ptpn13 A G 5: 103,624,987 (GRCm39) E97G probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Ptprs T C 17: 56,735,978 (GRCm39) T152A possibly damaging Het
Rims1 T C 1: 22,492,034 (GRCm39) D842G probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Rnf26rt C T 6: 76,473,942 (GRCm39) V225I probably benign Het
Rngtt T C 4: 33,330,889 (GRCm39) I164T probably damaging Het
Shisal1 A T 15: 84,290,886 (GRCm39) Y120* probably null Het
Ska3 C T 14: 58,047,534 (GRCm39) V334I probably benign Het
Slco1a8 T C 6: 141,918,061 (GRCm39) K605R probably benign Het
Srebf2 A G 15: 82,066,309 (GRCm39) K579R probably benign Het
Stxbp5 G A 10: 9,644,671 (GRCm39) T960I probably damaging Het
Suco A T 1: 161,671,565 (GRCm39) probably null Het
Tecta T C 9: 42,242,292 (GRCm39) T2094A probably damaging Het
Tenm4 A T 7: 96,344,087 (GRCm39) R227W probably damaging Het
Tmem131l A G 3: 83,805,893 (GRCm39) S1517P probably damaging Het
Trio A G 15: 27,748,177 (GRCm39) S2492P probably damaging Het
Tsg101 T C 7: 46,539,363 (GRCm39) *254W probably null Het
Ttn T C 2: 76,601,711 (GRCm39) T16872A probably benign Het
Ugt2b38 A G 5: 87,571,954 (GRCm39) V26A probably damaging Het
Upb1 T A 10: 75,275,672 (GRCm39) probably null Het
Vmn1r32 T A 6: 66,530,351 (GRCm39) I142F probably benign Het
Vmn1r60 C A 7: 5,547,710 (GRCm39) C130F possibly damaging Het
Vmn2r101 A G 17: 19,809,919 (GRCm39) D235G probably benign Het
Wnk1 C T 6: 119,979,241 (GRCm39) R282Q possibly damaging Het
Xrn2 T C 2: 146,903,207 (GRCm39) V765A probably benign Het
Zbed4 T C 15: 88,665,050 (GRCm39) S373P probably benign Het
Zfp251 A G 15: 76,737,836 (GRCm39) I414T possibly damaging Het
Zfp423 A T 8: 88,507,140 (GRCm39) L1047Q probably benign Het
Zfp426 A T 9: 20,384,413 (GRCm39) probably null Het
Zfp61 T C 7: 23,995,406 (GRCm39) M1V probably null Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66,393,945 (GRCm39) missense probably damaging 1.00
IGL00570:Scn9a APN 2 66,314,486 (GRCm39) missense probably damaging 1.00
IGL00809:Scn9a APN 2 66,314,279 (GRCm39) missense probably damaging 1.00
IGL00977:Scn9a APN 2 66,314,645 (GRCm39) missense probably damaging 0.99
IGL01120:Scn9a APN 2 66,357,316 (GRCm39) missense probably benign 0.00
IGL01134:Scn9a APN 2 66,335,312 (GRCm39) missense probably damaging 1.00
IGL01300:Scn9a APN 2 66,318,397 (GRCm39) nonsense probably null
IGL01452:Scn9a APN 2 66,357,416 (GRCm39) missense probably damaging 1.00
IGL01531:Scn9a APN 2 66,367,722 (GRCm39) missense probably benign 0.11
IGL01572:Scn9a APN 2 66,324,230 (GRCm39) missense probably benign 0.00
IGL01645:Scn9a APN 2 66,317,986 (GRCm39) missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66,314,386 (GRCm39) missense probably damaging 1.00
IGL01965:Scn9a APN 2 66,314,777 (GRCm39) missense probably damaging 1.00
IGL02127:Scn9a APN 2 66,325,170 (GRCm39) missense probably damaging 1.00
IGL02127:Scn9a APN 2 66,377,479 (GRCm39) missense probably damaging 1.00
IGL02166:Scn9a APN 2 66,323,447 (GRCm39) missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66,314,955 (GRCm39) splice site probably benign
IGL02640:Scn9a APN 2 66,366,440 (GRCm39) critical splice donor site probably null
IGL02685:Scn9a APN 2 66,367,637 (GRCm39) missense probably damaging 1.00
IGL02798:Scn9a APN 2 66,370,903 (GRCm39) missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66,398,373 (GRCm39) missense probably damaging 1.00
IGL03008:Scn9a APN 2 66,392,855 (GRCm39) missense probably damaging 1.00
IGL03270:Scn9a APN 2 66,314,358 (GRCm39) missense probably damaging 1.00
IGL03408:Scn9a APN 2 66,357,091 (GRCm39) missense probably benign 0.00
BB007:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
BB017:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
R0039:Scn9a UTSW 2 66,392,788 (GRCm39) missense probably damaging 0.98
R0173:Scn9a UTSW 2 66,363,437 (GRCm39) missense probably damaging 1.00
R0323:Scn9a UTSW 2 66,398,475 (GRCm39) missense probably damaging 1.00
R0344:Scn9a UTSW 2 66,335,354 (GRCm39) missense probably damaging 0.99
R0421:Scn9a UTSW 2 66,373,621 (GRCm39) missense probably benign
R0465:Scn9a UTSW 2 66,357,340 (GRCm39) missense probably damaging 1.00
R0514:Scn9a UTSW 2 66,314,022 (GRCm39) missense probably damaging 1.00
R0599:Scn9a UTSW 2 66,357,143 (GRCm39) missense probably damaging 0.96
R0627:Scn9a UTSW 2 66,367,721 (GRCm39) missense probably benign 0.00
R0644:Scn9a UTSW 2 66,363,405 (GRCm39) critical splice donor site probably null
R0653:Scn9a UTSW 2 66,363,721 (GRCm39) missense probably damaging 1.00
R0685:Scn9a UTSW 2 66,313,843 (GRCm39) missense probably benign 0.02
R0718:Scn9a UTSW 2 66,377,456 (GRCm39) missense probably damaging 1.00
R0827:Scn9a UTSW 2 66,366,468 (GRCm39) nonsense probably null
R0890:Scn9a UTSW 2 66,314,079 (GRCm39) missense probably damaging 1.00
R1139:Scn9a UTSW 2 66,335,341 (GRCm39) missense probably benign 0.02
R1385:Scn9a UTSW 2 66,393,886 (GRCm39) missense probably damaging 1.00
R1398:Scn9a UTSW 2 66,314,930 (GRCm39) missense probably benign 0.11
R1496:Scn9a UTSW 2 66,357,232 (GRCm39) missense probably benign
R1511:Scn9a UTSW 2 66,357,157 (GRCm39) missense probably benign 0.01
R1517:Scn9a UTSW 2 66,335,371 (GRCm39) splice site probably benign
R1564:Scn9a UTSW 2 66,314,648 (GRCm39) missense probably damaging 1.00
R1634:Scn9a UTSW 2 66,318,361 (GRCm39) missense probably damaging 1.00
R1662:Scn9a UTSW 2 66,313,803 (GRCm39) missense probably benign 0.00
R1695:Scn9a UTSW 2 66,335,220 (GRCm39) nonsense probably null
R1709:Scn9a UTSW 2 66,313,850 (GRCm39) missense probably damaging 1.00
R1741:Scn9a UTSW 2 66,317,938 (GRCm39) missense probably damaging 0.99
R1755:Scn9a UTSW 2 66,332,060 (GRCm39) missense probably benign 0.38
R1914:Scn9a UTSW 2 66,396,594 (GRCm39) missense probably damaging 1.00
R1962:Scn9a UTSW 2 66,314,655 (GRCm39) missense probably damaging 1.00
R1970:Scn9a UTSW 2 66,345,724 (GRCm39) missense probably damaging 0.97
R2017:Scn9a UTSW 2 66,345,665 (GRCm39) missense probably damaging 0.99
R2092:Scn9a UTSW 2 66,363,720 (GRCm39) missense probably damaging 0.99
R2105:Scn9a UTSW 2 66,398,527 (GRCm39) missense probably benign 0.25
R2114:Scn9a UTSW 2 66,314,396 (GRCm39) missense probably damaging 1.00
R2115:Scn9a UTSW 2 66,314,396 (GRCm39) missense probably damaging 1.00
R2128:Scn9a UTSW 2 66,356,998 (GRCm39) missense probably damaging 1.00
R2157:Scn9a UTSW 2 66,366,669 (GRCm39) missense probably damaging 1.00
R2162:Scn9a UTSW 2 66,364,573 (GRCm39) missense probably damaging 0.98
R2350:Scn9a UTSW 2 66,335,312 (GRCm39) missense probably damaging 1.00
R3694:Scn9a UTSW 2 66,392,749 (GRCm39) missense probably benign
R3771:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3772:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3922:Scn9a UTSW 2 66,357,217 (GRCm39) missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66,357,217 (GRCm39) missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66,395,398 (GRCm39) intron probably benign
R4385:Scn9a UTSW 2 66,314,900 (GRCm39) missense probably damaging 1.00
R4415:Scn9a UTSW 2 66,357,037 (GRCm39) missense probably damaging 1.00
R4570:Scn9a UTSW 2 66,313,902 (GRCm39) missense possibly damaging 0.85
R4682:Scn9a UTSW 2 66,377,362 (GRCm39) missense probably benign
R4783:Scn9a UTSW 2 66,370,967 (GRCm39) missense probably benign 0.01
R4822:Scn9a UTSW 2 66,314,093 (GRCm39) missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66,382,057 (GRCm39) missense probably benign
R4908:Scn9a UTSW 2 66,357,087 (GRCm39) missense probably benign 0.03
R4983:Scn9a UTSW 2 66,396,614 (GRCm39) missense probably benign 0.02
R5047:Scn9a UTSW 2 66,392,824 (GRCm39) missense probably damaging 1.00
R5100:Scn9a UTSW 2 66,364,463 (GRCm39) missense probably damaging 1.00
R5140:Scn9a UTSW 2 66,395,511 (GRCm39) missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66,318,387 (GRCm39) missense probably damaging 1.00
R5557:Scn9a UTSW 2 66,377,447 (GRCm39) missense probably damaging 0.99
R5582:Scn9a UTSW 2 66,395,373 (GRCm39) intron probably benign
R6108:Scn9a UTSW 2 66,314,393 (GRCm39) missense probably damaging 1.00
R6115:Scn9a UTSW 2 66,393,973 (GRCm39) missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66,317,868 (GRCm39) missense probably benign 0.00
R6261:Scn9a UTSW 2 66,314,240 (GRCm39) missense probably damaging 1.00
R6335:Scn9a UTSW 2 66,398,608 (GRCm39) start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66,357,307 (GRCm39) missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66,313,846 (GRCm39) missense probably benign 0.23
R6681:Scn9a UTSW 2 66,393,686 (GRCm39) missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66,398,373 (GRCm39) missense probably damaging 1.00
R7102:Scn9a UTSW 2 66,379,359 (GRCm39) missense probably damaging 1.00
R7186:Scn9a UTSW 2 66,364,567 (GRCm39) missense probably damaging 1.00
R7243:Scn9a UTSW 2 66,370,874 (GRCm39) missense probably damaging 1.00
R7311:Scn9a UTSW 2 66,314,748 (GRCm39) missense possibly damaging 0.54
R7328:Scn9a UTSW 2 66,314,931 (GRCm39) missense probably benign
R7386:Scn9a UTSW 2 66,370,894 (GRCm39) missense probably damaging 1.00
R7438:Scn9a UTSW 2 66,377,531 (GRCm39) missense possibly damaging 0.81
R7483:Scn9a UTSW 2 66,363,692 (GRCm39) missense probably damaging 0.99
R7485:Scn9a UTSW 2 66,364,561 (GRCm39) missense probably damaging 1.00
R7526:Scn9a UTSW 2 66,313,990 (GRCm39) missense probably benign
R7617:Scn9a UTSW 2 66,370,893 (GRCm39) missense possibly damaging 0.55
R7642:Scn9a UTSW 2 66,366,580 (GRCm39) missense probably benign 0.02
R7653:Scn9a UTSW 2 66,357,424 (GRCm39) missense probably damaging 1.00
R7747:Scn9a UTSW 2 66,314,642 (GRCm39) missense probably damaging 1.00
R7823:Scn9a UTSW 2 66,314,135 (GRCm39) missense probably damaging 1.00
R7864:Scn9a UTSW 2 66,314,904 (GRCm39) missense possibly damaging 0.73
R7890:Scn9a UTSW 2 66,373,456 (GRCm39) missense probably benign 0.00
R7930:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
R7975:Scn9a UTSW 2 66,314,597 (GRCm39) missense probably damaging 1.00
R8057:Scn9a UTSW 2 66,345,774 (GRCm39) missense probably benign 0.06
R8145:Scn9a UTSW 2 66,317,754 (GRCm39) missense probably damaging 1.00
R8163:Scn9a UTSW 2 66,314,745 (GRCm39) missense probably damaging 1.00
R8165:Scn9a UTSW 2 66,370,874 (GRCm39) missense probably damaging 1.00
R8342:Scn9a UTSW 2 66,366,626 (GRCm39) missense probably benign
R8345:Scn9a UTSW 2 66,324,966 (GRCm39) missense probably damaging 0.96
R8464:Scn9a UTSW 2 66,396,625 (GRCm39) missense probably damaging 0.99
R8467:Scn9a UTSW 2 66,332,015 (GRCm39) missense probably damaging 1.00
R8698:Scn9a UTSW 2 66,366,628 (GRCm39) missense probably benign 0.00
R8810:Scn9a UTSW 2 66,332,010 (GRCm39) missense probably damaging 1.00
R8822:Scn9a UTSW 2 66,370,979 (GRCm39) missense probably damaging 0.99
R8829:Scn9a UTSW 2 66,313,961 (GRCm39) missense probably benign
R9009:Scn9a UTSW 2 66,338,927 (GRCm39) missense probably damaging 1.00
R9038:Scn9a UTSW 2 66,325,147 (GRCm39) missense probably damaging 1.00
R9126:Scn9a UTSW 2 66,314,744 (GRCm39) missense probably damaging 1.00
R9205:Scn9a UTSW 2 66,363,657 (GRCm39) missense probably damaging 1.00
R9300:Scn9a UTSW 2 66,335,236 (GRCm39) missense probably benign 0.39
R9373:Scn9a UTSW 2 66,314,261 (GRCm39) missense probably benign 0.00
R9404:Scn9a UTSW 2 66,357,040 (GRCm39) missense probably benign 0.02
R9443:Scn9a UTSW 2 66,395,553 (GRCm39) missense probably damaging 1.00
R9590:Scn9a UTSW 2 66,314,328 (GRCm39) missense probably benign 0.05
R9612:Scn9a UTSW 2 66,363,708 (GRCm39) missense probably damaging 1.00
R9617:Scn9a UTSW 2 66,392,809 (GRCm39) missense probably damaging 1.00
R9717:Scn9a UTSW 2 66,357,002 (GRCm39) missense probably benign
X0003:Scn9a UTSW 2 66,338,991 (GRCm39) missense probably benign 0.02
X0062:Scn9a UTSW 2 66,398,421 (GRCm39) missense probably damaging 1.00
Z1176:Scn9a UTSW 2 66,370,936 (GRCm39) missense probably benign 0.00
Z1177:Scn9a UTSW 2 66,325,029 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ATCAAAACCGAAGCTCTATTTCCTG -3'
(R):5'- GAGATGGATTCCCTTCGTTCAC -3'

Sequencing Primer
(F):5'- AAACCGAAGCTCTATTTCCTGCTTTC -3'
(R):5'- GATTCCCTTCGTTCACAGATGGAAG -3'
Posted On 2015-03-25