Mutagenetix > Incidental Mutation

Incidental Mutation 'R3773:Nup210l'

273412

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

MMRRC Submission

040749-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.459) question?

Stock #

R3773 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to G at 90119894 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 194 (Y194*)

Ref Sequence

ENSEMBL: ENSMUSP00000143368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]

AlphaFold

Q9D2F7

Predicted Effect

probably null
Transcript: ENSMUST00000029548
AA Change: Y194*

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: Y194*

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000200410
AA Change: Y194*

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: Y194*

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Meta Mutation Damage Score

0.9716

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	C	17: 56,876,262	M1T	probably null	Het
1810041L15Rik	A	T	15: 84,406,685	Y120*	probably null	Het
A2ml1	T	A	6: 128,555,083	K899N	probably benign	Het
Adgrv1	G	A	13: 81,499,043	S3126L	probably damaging	Het
Apba3	C	A	10: 81,272,609		probably null	Het
Apobec4	G	T	1: 152,756,805	A195S	probably benign	Het
Asap3	C	T	4: 136,227,575	T72I	probably benign	Het
BC067074	A	G	13: 113,318,209	E263G	probably benign	Het
Cand2	T	A	6: 115,785,217	H201Q	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Chd1	A	G	17: 17,374,651	D16G	probably damaging	Het
Csgalnact2	T	C	6: 118,126,219	K19E	probably benign	Het
Cyp17a1	T	G	19: 46,669,723	K250T	probably damaging	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Dgcr8	T	C	16: 18,256,775	D712G	probably damaging	Het
Dsg2	T	C	18: 20,591,862	W442R	probably damaging	Het
Elavl2	C	T	4: 91,264,088	G131R	probably damaging	Het
Elf1	T	C	14: 79,567,210	V105A	possibly damaging	Het
Ercc6l2	A	G	13: 63,841,450	D270G	probably damaging	Het
Fmn1	T	G	2: 113,582,118	S996A	probably damaging	Het
Frmd4a	A	T	2: 4,590,622	E109D	probably damaging	Het
Fry	A	T	5: 150,398,198	R999S	probably damaging	Het
Gak	G	A	5: 108,582,672	T956I	probably benign	Het
Gm6614	T	C	6: 141,972,335	K605R	probably benign	Het
Gm9008	C	T	6: 76,496,959	V225I	probably benign	Het
Gps2	T	C	11: 69,916,101	F21L	probably damaging	Het
Grhl3	C	T	4: 135,555,847	W303*	probably null	Het
Hmcn2	C	T	2: 31,360,896	T790M	probably damaging	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Matk	T	A	10: 81,258,297	L21Q	probably benign	Het
Mthfr	T	C	4: 148,044,450	V160A	probably benign	Het
Nhlrc4	T	A	17: 25,943,393	K127*	probably null	Het
Nsd1	G	A	13: 55,246,673	V696I	probably benign	Het
Olfr1497	T	A	19: 13,795,204	M136L	probably benign	Het
Olfr345	A	T	2: 36,640,321	Y94F	probably benign	Het
Olfr57	G	A	10: 79,035,180	C128Y	possibly damaging	Het
Olfr90	G	T	17: 37,086,065	Y33*	probably null	Het
Pcdhb15	T	A	18: 37,475,890	V725D	probably benign	Het
Pes1	A	G	11: 3,975,548	Y221C	probably damaging	Het
Prkd3	T	C	17: 78,959,106	I603V	possibly damaging	Het
Ptpn13	A	G	5: 103,477,121	E97G	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ptprs	T	C	17: 56,428,978	T152A	possibly damaging	Het
Rims1	T	C	1: 22,421,810	D842G	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rngtt	T	C	4: 33,330,889	I164T	probably damaging	Het
Scn9a	T	C	2: 66,483,648	N1909D	probably benign	Het
Ska3	C	T	14: 57,810,077	V334I	probably benign	Het
Srebf2	A	G	15: 82,182,108	K579R	probably benign	Het
Stxbp5	G	A	10: 9,768,927	T960I	probably damaging	Het
Suco	A	T	1: 161,843,996		probably null	Het
Tecta	T	C	9: 42,330,996	T2094A	probably damaging	Het
Tenm4	A	T	7: 96,694,880	R227W	probably damaging	Het
Tmem131l	A	G	3: 83,898,586	S1517P	probably damaging	Het
Trio	A	G	15: 27,748,091	S2492P	probably damaging	Het
Tsg101	T	C	7: 46,889,615	*254W	probably null	Het
Ttn	T	C	2: 76,771,367	T16872A	probably benign	Het
Ugt2b38	A	G	5: 87,424,095	V26A	probably damaging	Het
Upb1	T	A	10: 75,439,838		probably null	Het
Vmn1r32	T	A	6: 66,553,367	I142F	probably benign	Het
Vmn1r60	C	A	7: 5,544,711	C130F	possibly damaging	Het
Vmn2r101	A	G	17: 19,589,657	D235G	probably benign	Het
Wnk1	C	T	6: 120,002,280	R282Q	possibly damaging	Het
Xrn2	T	C	2: 147,061,287	V765A	probably benign	Het
Zbed4	T	C	15: 88,780,847	S373P	probably benign	Het
Zfp251	A	G	15: 76,853,636	I414T	possibly damaging	Het
Zfp423	A	T	8: 87,780,512	L1047Q	probably benign	Het
Zfp426	A	T	9: 20,473,117		probably null	Het
Zfp61	T	C	7: 24,295,981	M1V	probably null	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0090:Nup210l	UTSW	3	90211779	missense	probably benign	0.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0332:Nup210l	UTSW	3	90132309	splice site	probably benign
R0346:Nup210l	UTSW	3	90189438	missense	probably damaging	1.00
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1471:Nup210l	UTSW	3	90170562	missense	probably benign
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1843:Nup210l	UTSW	3	90172086	missense	probably damaging	0.96
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2015:Nup210l	UTSW	3	90185432	missense	probably damaging	1.00
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4290:Nup210l	UTSW	3	90207326	missense	probably benign	0.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	splice site	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6293:Nup210l	UTSW	3	90115064	missense	probably damaging	1.00
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86
R6980:Nup210l	UTSW	3	90119927	missense	probably benign	0.04
R7038:Nup210l	UTSW	3	90159947	missense	probably damaging	1.00
R7273:Nup210l	UTSW	3	90118547	missense	probably benign	0.04
R7450:Nup210l	UTSW	3	90115188	critical splice donor site	probably null
R7514:Nup210l	UTSW	3	90210459	critical splice donor site	probably null
R7658:Nup210l	UTSW	3	90211993	missense	probably benign	0.43
R7735:Nup210l	UTSW	3	90185576	missense	probably damaging	1.00
R7772:Nup210l	UTSW	3	90159926	missense	probably damaging	1.00
R7800:Nup210l	UTSW	3	90134597	missense	probably damaging	1.00
R7840:Nup210l	UTSW	3	90122729	missense	probably benign	0.08
R7847:Nup210l	UTSW	3	90151123	missense	probably benign
R7848:Nup210l	UTSW	3	90203905	missense	probably benign	0.01
R8084:Nup210l	UTSW	3	90136058	missense	probably benign	0.15
R8121:Nup210l	UTSW	3	90115121	missense	probably damaging	1.00
R8421:Nup210l	UTSW	3	90203867	missense	probably damaging	1.00
R8458:Nup210l	UTSW	3	90185567	missense	probably null	1.00
R8701:Nup210l	UTSW	3	90122814	missense	probably benign	0.41
R8720:Nup210l	UTSW	3	90210374	missense	probably benign	0.00
R8770:Nup210l	UTSW	3	90118543	missense	probably damaging	1.00
R8896:Nup210l	UTSW	3	90118625	missense	probably damaging	1.00
R9033:Nup210l	UTSW	3	90198089	missense	probably benign
R9371:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9373:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9381:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9426:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9427:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9501:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9523:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9574:Nup210l	UTSW	3	90210386	missense	probably benign
R9612:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9654:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9660:Nup210l	UTSW	3	90198095	missense	probably benign	0.30
R9660:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9662:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9682:Nup210l	UTSW	3	90144162	missense	possibly damaging	0.79
R9729:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9750:Nup210l	UTSW	3	90210352	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGGCACAGGATTCTAGAAGTGG -3'
(R):5'- ATTGCAAGACCTCAGACGG -3'

Sequencing Primer
(F):5'- AGTTCAAGTTAGAGCCCAGCCTG -3'
(R):5'- AAGACCTCAGACGGCTGTTTCTAG -3'

Posted On

2015-03-25