Incidental Mutation 'R3773:Elavl2'
ID273414
Institutional Source Beutler Lab
Gene Symbol Elavl2
Ensembl Gene ENSMUSG00000008489
Gene NameELAV like RNA binding protein 1
Synonymsmel-N1, Hub
MMRRC Submission 040749-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.463) question?
Stock #R3773 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location91250763-91400785 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91264088 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 131 (G131R)
Ref Sequence ENSEMBL: ENSMUSP00000102727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008633] [ENSMUST00000102799] [ENSMUST00000107109] [ENSMUST00000107110] [ENSMUST00000107111] [ENSMUST00000107116] [ENSMUST00000107118] [ENSMUST00000107120] [ENSMUST00000107124] [ENSMUST00000177109]
Predicted Effect probably damaging
Transcript: ENSMUST00000008633
AA Change: G131R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000008633
Gene: ENSMUSG00000008489
AA Change: G131R

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 278 351 5.15e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102799
AA Change: G145R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099863
Gene: ENSMUSG00000008489
AA Change: G145R

DomainStartEndE-ValueType
RRM 54 127 1.44e-24 SMART
RRM 140 215 2.35e-20 SMART
RRM 291 364 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107109
AA Change: G131R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102726
Gene: ENSMUSG00000008489
AA Change: G131R

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 277 350 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107110
AA Change: G131R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102727
Gene: ENSMUSG00000008489
AA Change: G131R

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 265 338 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107111
AA Change: G131R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102728
Gene: ENSMUSG00000008489
AA Change: G131R

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 264 337 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107116
AA Change: G160R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102733
Gene: ENSMUSG00000008489
AA Change: G160R

DomainStartEndE-ValueType
RRM 69 142 1.44e-24 SMART
RRM 155 230 2.35e-20 SMART
RRM 307 380 5.15e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107118
AA Change: G160R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102735
Gene: ENSMUSG00000008489
AA Change: G160R

DomainStartEndE-ValueType
RRM 69 142 1.44e-24 SMART
RRM 155 230 2.35e-20 SMART
RRM 294 367 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107120
AA Change: G160R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102737
Gene: ENSMUSG00000008489
AA Change: G160R

DomainStartEndE-ValueType
RRM 69 142 1.44e-24 SMART
RRM 155 230 2.35e-20 SMART
RRM 306 379 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107124
AA Change: G131R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102741
Gene: ENSMUSG00000008489
AA Change: G131R

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 277 350 5.15e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176469
Predicted Effect probably benign
Transcript: ENSMUST00000177109
SMART Domains Protein: ENSMUSP00000135780
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a neural-specific RNA-binding protein that is known to bind to several 3' UTRs, including its own and also that of FOS and ID. The encoded protein may recognize a GAAA motif in the RNA. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,876,262 M1T probably null Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
A2ml1 T A 6: 128,555,083 K899N probably benign Het
Adgrv1 G A 13: 81,499,043 S3126L probably damaging Het
Apba3 C A 10: 81,272,609 probably null Het
Apobec4 G T 1: 152,756,805 A195S probably benign Het
Asap3 C T 4: 136,227,575 T72I probably benign Het
BC067074 A G 13: 113,318,209 E263G probably benign Het
Cand2 T A 6: 115,785,217 H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Csgalnact2 T C 6: 118,126,219 K19E probably benign Het
Cyp17a1 T G 19: 46,669,723 K250T probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dgcr8 T C 16: 18,256,775 D712G probably damaging Het
Dsg2 T C 18: 20,591,862 W442R probably damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Ercc6l2 A G 13: 63,841,450 D270G probably damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Fry A T 5: 150,398,198 R999S probably damaging Het
Gak G A 5: 108,582,672 T956I probably benign Het
Gm6614 T C 6: 141,972,335 K605R probably benign Het
Gm9008 C T 6: 76,496,959 V225I probably benign Het
Gps2 T C 11: 69,916,101 F21L probably damaging Het
Grhl3 C T 4: 135,555,847 W303* probably null Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Matk T A 10: 81,258,297 L21Q probably benign Het
Mthfr T C 4: 148,044,450 V160A probably benign Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Olfr1497 T A 19: 13,795,204 M136L probably benign Het
Olfr345 A T 2: 36,640,321 Y94F probably benign Het
Olfr57 G A 10: 79,035,180 C128Y possibly damaging Het
Olfr90 G T 17: 37,086,065 Y33* probably null Het
Pcdhb15 T A 18: 37,475,890 V725D probably benign Het
Pes1 A G 11: 3,975,548 Y221C probably damaging Het
Prkd3 T C 17: 78,959,106 I603V possibly damaging Het
Ptpn13 A G 5: 103,477,121 E97G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rims1 T C 1: 22,421,810 D842G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rngtt T C 4: 33,330,889 I164T probably damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Stxbp5 G A 10: 9,768,927 T960I probably damaging Het
Suco A T 1: 161,843,996 probably null Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tmem131l A G 3: 83,898,586 S1517P probably damaging Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Tsg101 T C 7: 46,889,615 *254W probably null Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Upb1 T A 10: 75,439,838 probably null Het
Vmn1r32 T A 6: 66,553,367 I142F probably benign Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 T C 15: 88,780,847 S373P probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp423 A T 8: 87,780,512 L1047Q probably benign Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Elavl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Elavl2 APN 4 91264072 missense probably damaging 1.00
IGL01886:Elavl2 APN 4 91264093 missense probably damaging 1.00
IGL02016:Elavl2 APN 4 91260935 missense probably damaging 1.00
IGL02024:Elavl2 APN 4 91253539 missense probably benign 0.02
IGL02860:Elavl2 APN 4 91260953 missense probably damaging 1.00
R0458:Elavl2 UTSW 4 91308867 splice site probably benign
R1294:Elavl2 UTSW 4 91311589 missense probably benign 0.02
R1778:Elavl2 UTSW 4 91253478 missense probably damaging 1.00
R2063:Elavl2 UTSW 4 91253450 missense possibly damaging 0.81
R2190:Elavl2 UTSW 4 91264094 missense probably benign 0.22
R4473:Elavl2 UTSW 4 91261009 splice site probably null
R4784:Elavl2 UTSW 4 91254142 missense probably null 0.97
R4911:Elavl2 UTSW 4 91308678 missense possibly damaging 0.91
R5396:Elavl2 UTSW 4 91260818 missense probably damaging 1.00
R6708:Elavl2 UTSW 4 91253397 missense probably damaging 1.00
R6882:Elavl2 UTSW 4 91308715 missense probably damaging 1.00
R7592:Elavl2 UTSW 4 91311571 critical splice donor site probably null
R7849:Elavl2 UTSW 4 91372043 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAATTGCATTTTCTGGCCCAC -3'
(R):5'- ACAGCACACACTTGTCTTTAGAC -3'

Sequencing Primer
(F):5'- GGCCCACATATACCTTTGATGTG -3'
(R):5'- TCTTTAGACAGCGCTGGC -3'
Posted On2015-03-25