Incidental Mutation 'R3773:Mthfr'
ID273417
Institutional Source Beutler Lab
Gene Symbol Mthfr
Ensembl Gene ENSMUSG00000029009
Gene Namemethylenetetrahydrofolate reductase
Synonyms
MMRRC Submission 040749-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.811) question?
Stock #R3773 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location148039077-148059551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148044450 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 160 (V160A)
Ref Sequence ENSEMBL: ENSMUSP00000116239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069604] [ENSMUST00000097788] [ENSMUST00000141283] [ENSMUST00000152498]
Predicted Effect probably benign
Transcript: ENSMUST00000069604
AA Change: V201A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069774
Gene: ENSMUSG00000029009
AA Change: V201A

DomainStartEndE-ValueType
low complexity region 48 73 N/A INTRINSIC
Pfam:MTHFR 88 377 2.3e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097788
AA Change: V160A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095395
Gene: ENSMUSG00000029009
AA Change: V160A

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
Pfam:MTHFR 47 336 5.9e-121 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125978
Predicted Effect probably benign
Transcript: ENSMUST00000141283
AA Change: V160A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116239
Gene: ENSMUSG00000029009
AA Change: V160A

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
Pfam:MTHFR 47 194 7.4e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145115
Predicted Effect probably benign
Transcript: ENSMUST00000152498
AA Change: V176A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117095
Gene: ENSMUSG00000029009
AA Change: V176A

DomainStartEndE-ValueType
low complexity region 23 48 N/A INTRINSIC
Pfam:MTHFR 63 352 2.4e-121 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine. Genetic variation in this gene influences susceptibility to occlusive vascular disease, neural tube defects, colon cancer and acute leukemia, and mutations in this gene are associated with methylenetetrahydrofolate reductase deficiency.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have elevated plasma levels of homocysteine. They also display delayed growth and development and a reduced survival rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,876,262 M1T probably null Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
A2ml1 T A 6: 128,555,083 K899N probably benign Het
Adgrv1 G A 13: 81,499,043 S3126L probably damaging Het
Apba3 C A 10: 81,272,609 probably null Het
Apobec4 G T 1: 152,756,805 A195S probably benign Het
Asap3 C T 4: 136,227,575 T72I probably benign Het
BC067074 A G 13: 113,318,209 E263G probably benign Het
Cand2 T A 6: 115,785,217 H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Csgalnact2 T C 6: 118,126,219 K19E probably benign Het
Cyp17a1 T G 19: 46,669,723 K250T probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dgcr8 T C 16: 18,256,775 D712G probably damaging Het
Dsg2 T C 18: 20,591,862 W442R probably damaging Het
Elavl2 C T 4: 91,264,088 G131R probably damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Ercc6l2 A G 13: 63,841,450 D270G probably damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Fry A T 5: 150,398,198 R999S probably damaging Het
Gak G A 5: 108,582,672 T956I probably benign Het
Gm6614 T C 6: 141,972,335 K605R probably benign Het
Gm9008 C T 6: 76,496,959 V225I probably benign Het
Gps2 T C 11: 69,916,101 F21L probably damaging Het
Grhl3 C T 4: 135,555,847 W303* probably null Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Matk T A 10: 81,258,297 L21Q probably benign Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Olfr1497 T A 19: 13,795,204 M136L probably benign Het
Olfr345 A T 2: 36,640,321 Y94F probably benign Het
Olfr57 G A 10: 79,035,180 C128Y possibly damaging Het
Olfr90 G T 17: 37,086,065 Y33* probably null Het
Pcdhb15 T A 18: 37,475,890 V725D probably benign Het
Pes1 A G 11: 3,975,548 Y221C probably damaging Het
Prkd3 T C 17: 78,959,106 I603V possibly damaging Het
Ptpn13 A G 5: 103,477,121 E97G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rims1 T C 1: 22,421,810 D842G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rngtt T C 4: 33,330,889 I164T probably damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Stxbp5 G A 10: 9,768,927 T960I probably damaging Het
Suco A T 1: 161,843,996 probably null Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tmem131l A G 3: 83,898,586 S1517P probably damaging Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Tsg101 T C 7: 46,889,615 *254W probably null Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Upb1 T A 10: 75,439,838 probably null Het
Vmn1r32 T A 6: 66,553,367 I142F probably benign Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 T C 15: 88,780,847 S373P probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp423 A T 8: 87,780,512 L1047Q probably benign Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Mthfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Mthfr APN 4 148041270 missense probably benign
IGL00911:Mthfr APN 4 148041302 missense probably benign 0.01
R0116:Mthfr UTSW 4 148051523 missense probably benign 0.00
R0207:Mthfr UTSW 4 148052224 missense probably damaging 1.00
R0268:Mthfr UTSW 4 148055428 missense probably damaging 1.00
R0344:Mthfr UTSW 4 148055428 missense probably damaging 1.00
R0762:Mthfr UTSW 4 148055443 missense possibly damaging 0.65
R1433:Mthfr UTSW 4 148055443 missense possibly damaging 0.92
R1464:Mthfr UTSW 4 148053572 splice site probably benign
R1972:Mthfr UTSW 4 148051927 missense probably damaging 1.00
R3154:Mthfr UTSW 4 148051604 missense probably benign 0.12
R3407:Mthfr UTSW 4 148055061 missense probably damaging 1.00
R4153:Mthfr UTSW 4 148051475 missense probably damaging 0.99
R4291:Mthfr UTSW 4 148055492 missense probably damaging 1.00
R4487:Mthfr UTSW 4 148051427 missense probably benign 0.00
R4574:Mthfr UTSW 4 148043541 missense possibly damaging 0.95
R4583:Mthfr UTSW 4 148051872 missense possibly damaging 0.80
R4847:Mthfr UTSW 4 148048139 missense probably damaging 0.99
R5183:Mthfr UTSW 4 148051360 splice site probably null
R5536:Mthfr UTSW 4 148044483 missense probably damaging 1.00
R5664:Mthfr UTSW 4 148055466 missense probably damaging 1.00
R6161:Mthfr UTSW 4 148041754 missense probably benign 0.35
R7285:Mthfr UTSW 4 148053599 missense probably benign 0.01
R7427:Mthfr UTSW 4 148051603 missense probably benign 0.00
R7428:Mthfr UTSW 4 148051603 missense probably benign 0.00
R7474:Mthfr UTSW 4 148052602 missense possibly damaging 0.95
R7823:Mthfr UTSW 4 148051487 missense probably benign 0.29
R7826:Mthfr UTSW 4 148055010 missense probably benign 0.00
R7975:Mthfr UTSW 4 148043463 missense probably damaging 1.00
R8669:Mthfr UTSW 4 148051477 missense probably benign 0.21
R8698:Mthfr UTSW 4 148044490 nonsense probably null
R8714:Mthfr UTSW 4 148041818 missense probably damaging 1.00
R8790:Mthfr UTSW 4 148055534 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATTTGACAACTGACCACTGCC -3'
(R):5'- GGTGCCATTCAGTTCACCTCTG -3'

Sequencing Primer
(F):5'- TGACCACTGCCCTGCAC -3'
(R):5'- TCTGTATCCACCCAATCAACACGTC -3'
Posted On2015-03-25