Incidental Mutation 'R3773:Tsg101'
ID273434
Institutional Source Beutler Lab
Gene Symbol Tsg101
Ensembl Gene ENSMUSG00000014402
Gene Nametumor susceptibility gene 101
SynonymsCC2
MMRRC Submission 040749-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3773 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46888949-46919969 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 46889615 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 254 (*254W)
Ref Sequence ENSEMBL: ENSMUSP00000147748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014546] [ENSMUST00000156335] [ENSMUST00000209538] [ENSMUST00000211076]
Predicted Effect probably null
Transcript: ENSMUST00000014546
AA Change: *392W
SMART Domains Protein: ENSMUSP00000014546
Gene: ENSMUSG00000014402
AA Change: *392W

DomainStartEndE-ValueType
UBCc 22 177 5.96e-4 SMART
PDB:3IV1|H 229 305 1e-43 PDB
Pfam:Vps23_core 317 380 2.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146130
Predicted Effect probably benign
Transcript: ENSMUST00000156335
SMART Domains Protein: ENSMUSP00000120856
Gene: ENSMUSG00000014402

DomainStartEndE-ValueType
UBCc 51 206 5.96e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000209538
AA Change: *254W
Predicted Effect probably benign
Transcript: ENSMUST00000211076
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced growth, fail to form mesoderm, accumulate p53 protein and die by embryonic day 6.5. Homozygotes for a mammary gland-specific knockout show impaired mammogenesis and are unable to nurse their pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,876,262 M1T probably null Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
A2ml1 T A 6: 128,555,083 K899N probably benign Het
Adgrv1 G A 13: 81,499,043 S3126L probably damaging Het
Apba3 C A 10: 81,272,609 probably null Het
Apobec4 G T 1: 152,756,805 A195S probably benign Het
Asap3 C T 4: 136,227,575 T72I probably benign Het
BC067074 A G 13: 113,318,209 E263G probably benign Het
Cand2 T A 6: 115,785,217 H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Csgalnact2 T C 6: 118,126,219 K19E probably benign Het
Cyp17a1 T G 19: 46,669,723 K250T probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dgcr8 T C 16: 18,256,775 D712G probably damaging Het
Dsg2 T C 18: 20,591,862 W442R probably damaging Het
Elavl2 C T 4: 91,264,088 G131R probably damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Ercc6l2 A G 13: 63,841,450 D270G probably damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Fry A T 5: 150,398,198 R999S probably damaging Het
Gak G A 5: 108,582,672 T956I probably benign Het
Gm6614 T C 6: 141,972,335 K605R probably benign Het
Gm9008 C T 6: 76,496,959 V225I probably benign Het
Gps2 T C 11: 69,916,101 F21L probably damaging Het
Grhl3 C T 4: 135,555,847 W303* probably null Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Matk T A 10: 81,258,297 L21Q probably benign Het
Mthfr T C 4: 148,044,450 V160A probably benign Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Olfr1497 T A 19: 13,795,204 M136L probably benign Het
Olfr345 A T 2: 36,640,321 Y94F probably benign Het
Olfr57 G A 10: 79,035,180 C128Y possibly damaging Het
Olfr90 G T 17: 37,086,065 Y33* probably null Het
Pcdhb15 T A 18: 37,475,890 V725D probably benign Het
Pes1 A G 11: 3,975,548 Y221C probably damaging Het
Prkd3 T C 17: 78,959,106 I603V possibly damaging Het
Ptpn13 A G 5: 103,477,121 E97G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rims1 T C 1: 22,421,810 D842G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rngtt T C 4: 33,330,889 I164T probably damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Stxbp5 G A 10: 9,768,927 T960I probably damaging Het
Suco A T 1: 161,843,996 probably null Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tmem131l A G 3: 83,898,586 S1517P probably damaging Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Upb1 T A 10: 75,439,838 probably null Het
Vmn1r32 T A 6: 66,553,367 I142F probably benign Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 T C 15: 88,780,847 S373P probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp423 A T 8: 87,780,512 L1047Q probably benign Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Tsg101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Tsg101 APN 7 46908925 missense probably damaging 1.00
IGL01505:Tsg101 APN 7 46909060 missense probably damaging 1.00
R1183:Tsg101 UTSW 7 46889624 missense probably benign 0.23
R1558:Tsg101 UTSW 7 46889689 missense probably damaging 1.00
R1560:Tsg101 UTSW 7 46892460 splice site probably null
R1779:Tsg101 UTSW 7 46907087 missense probably benign 0.00
R2015:Tsg101 UTSW 7 46908904 critical splice donor site probably null
R2329:Tsg101 UTSW 7 46891120 missense probably damaging 1.00
R4108:Tsg101 UTSW 7 46892494 missense probably damaging 1.00
R4618:Tsg101 UTSW 7 46892509 missense possibly damaging 0.76
R5162:Tsg101 UTSW 7 46892426 missense probably damaging 1.00
R5380:Tsg101 UTSW 7 46891120 missense probably damaging 1.00
R5537:Tsg101 UTSW 7 46891128 missense probably benign 0.02
R6939:Tsg101 UTSW 7 46907099 missense probably benign 0.00
R7555:Tsg101 UTSW 7 46913411 missense probably damaging 1.00
R7752:Tsg101 UTSW 7 46913435 missense probably benign 0.01
R7901:Tsg101 UTSW 7 46913435 missense probably benign 0.01
R7951:Tsg101 UTSW 7 46891143 missense probably benign 0.38
R8052:Tsg101 UTSW 7 46892509 missense probably damaging 0.96
R8329:Tsg101 UTSW 7 46909060 missense probably damaging 1.00
R8524:Tsg101 UTSW 7 46892367 missense probably benign 0.01
X0063:Tsg101 UTSW 7 46889631 missense probably damaging 1.00
Z1177:Tsg101 UTSW 7 46890936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATTTAGCCCAGTCAGTCCCAG -3'
(R):5'- CAATTGGTTTCAAAGGTTGCTG -3'

Sequencing Primer
(F):5'- CAGCACAGACGCTTACAGAGG -3'
(R):5'- AGGTTGCTGTATATATTTAGGATTGC -3'
Posted On2015-03-25