Incidental Mutation 'R3773:Cd109'
ID273441
Institutional Source Beutler Lab
Gene Symbol Cd109
Ensembl Gene ENSMUSG00000046186
Gene NameCD109 antigen
SynonymsGov platelet alloantigens, 9930012E15Rik
MMRRC Submission 040749-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3773 (G1)
Quality Score148
Status Not validated
Chromosome9
Chromosomal Location78615546-78716253 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT at 78712500 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093812]
Predicted Effect probably benign
Transcript: ENSMUST00000093812
SMART Domains Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A2M_N 129 220 1.5e-16 PFAM
A2M_N_2 470 601 8.89e-32 SMART
A2M 695 786 2.07e-32 SMART
Pfam:Thiol-ester_cl 912 941 2.6e-20 PFAM
Pfam:A2M_comp 961 1197 1.9e-65 PFAM
low complexity region 1265 1275 N/A INTRINSIC
A2M_recep 1311 1395 2.06e-27 SMART
low complexity region 1422 1437 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,876,262 M1T probably null Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
A2ml1 T A 6: 128,555,083 K899N probably benign Het
Adgrv1 G A 13: 81,499,043 S3126L probably damaging Het
Apba3 C A 10: 81,272,609 probably null Het
Apobec4 G T 1: 152,756,805 A195S probably benign Het
Asap3 C T 4: 136,227,575 T72I probably benign Het
BC067074 A G 13: 113,318,209 E263G probably benign Het
Cand2 T A 6: 115,785,217 H201Q probably damaging Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Csgalnact2 T C 6: 118,126,219 K19E probably benign Het
Cyp17a1 T G 19: 46,669,723 K250T probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dgcr8 T C 16: 18,256,775 D712G probably damaging Het
Dsg2 T C 18: 20,591,862 W442R probably damaging Het
Elavl2 C T 4: 91,264,088 G131R probably damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Ercc6l2 A G 13: 63,841,450 D270G probably damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Fry A T 5: 150,398,198 R999S probably damaging Het
Gak G A 5: 108,582,672 T956I probably benign Het
Gm6614 T C 6: 141,972,335 K605R probably benign Het
Gm9008 C T 6: 76,496,959 V225I probably benign Het
Gps2 T C 11: 69,916,101 F21L probably damaging Het
Grhl3 C T 4: 135,555,847 W303* probably null Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Matk T A 10: 81,258,297 L21Q probably benign Het
Mthfr T C 4: 148,044,450 V160A probably benign Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Olfr1497 T A 19: 13,795,204 M136L probably benign Het
Olfr345 A T 2: 36,640,321 Y94F probably benign Het
Olfr57 G A 10: 79,035,180 C128Y possibly damaging Het
Olfr90 G T 17: 37,086,065 Y33* probably null Het
Pcdhb15 T A 18: 37,475,890 V725D probably benign Het
Pes1 A G 11: 3,975,548 Y221C probably damaging Het
Prkd3 T C 17: 78,959,106 I603V possibly damaging Het
Ptpn13 A G 5: 103,477,121 E97G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rims1 T C 1: 22,421,810 D842G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rngtt T C 4: 33,330,889 I164T probably damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Stxbp5 G A 10: 9,768,927 T960I probably damaging Het
Suco A T 1: 161,843,996 probably null Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tmem131l A G 3: 83,898,586 S1517P probably damaging Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Tsg101 T C 7: 46,889,615 *254W probably null Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Upb1 T A 10: 75,439,838 probably null Het
Vmn1r32 T A 6: 66,553,367 I142F probably benign Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 T C 15: 88,780,847 S373P probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp423 A T 8: 87,780,512 L1047Q probably benign Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Cd109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd109 APN 9 78616969 missense probably damaging 1.00
IGL00465:Cd109 APN 9 78660934 nonsense probably null
IGL00667:Cd109 APN 9 78684877 missense probably damaging 0.99
IGL01432:Cd109 APN 9 78698123 missense probably benign
IGL01795:Cd109 APN 9 78661765 splice site probably benign
IGL02343:Cd109 APN 9 78688955 splice site probably benign
IGL02450:Cd109 APN 9 78695850 missense possibly damaging 0.83
IGL02699:Cd109 APN 9 78671989 splice site probably benign
IGL02738:Cd109 APN 9 78691299 missense probably damaging 1.00
IGL02797:Cd109 APN 9 78661713 missense probably damaging 0.96
IGL03160:Cd109 APN 9 78661056 splice site probably null
IGL03349:Cd109 APN 9 78636485 missense probably benign 0.34
FR4589:Cd109 UTSW 9 78712529 critical splice acceptor site probably benign
R0048:Cd109 UTSW 9 78680021 missense possibly damaging 0.50
R0060:Cd109 UTSW 9 78703107 missense probably damaging 1.00
R0060:Cd109 UTSW 9 78703107 missense probably damaging 1.00
R0158:Cd109 UTSW 9 78688932 missense possibly damaging 0.49
R0415:Cd109 UTSW 9 78712615 missense probably benign 0.13
R0659:Cd109 UTSW 9 78680170 splice site probably benign
R0709:Cd109 UTSW 9 78671978 missense possibly damaging 0.93
R0840:Cd109 UTSW 9 78664330 missense probably benign 0.04
R0909:Cd109 UTSW 9 78636473 missense probably benign 0.01
R0945:Cd109 UTSW 9 78688941 missense possibly damaging 0.51
R1344:Cd109 UTSW 9 78672550 critical splice acceptor site probably null
R1471:Cd109 UTSW 9 78654587 missense probably damaging 1.00
R1484:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R1570:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R1688:Cd109 UTSW 9 78705091 missense probably benign 0.17
R1773:Cd109 UTSW 9 78703724 missense probably benign 0.21
R1813:Cd109 UTSW 9 78617005 missense probably benign 0.04
R2004:Cd109 UTSW 9 78703762 missense probably benign 0.00
R2083:Cd109 UTSW 9 78667293 missense probably damaging 1.00
R2483:Cd109 UTSW 9 78667357 missense probably damaging 1.00
R2857:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2858:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2859:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2911:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2912:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2914:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2927:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3623:Cd109 UTSW 9 78667357 missense probably damaging 1.00
R3713:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3760:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3762:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3771:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3772:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3916:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3917:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4117:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4260:Cd109 UTSW 9 78636463 missense possibly damaging 0.67
R4387:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4389:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4526:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4527:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4528:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4700:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4708:Cd109 UTSW 9 78672589 missense probably benign 0.00
R4723:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4750:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4751:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4754:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4755:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4773:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4984:Cd109 UTSW 9 78634677 critical splice donor site probably null
R5259:Cd109 UTSW 9 78710152 missense probably benign 0.30
R5353:Cd109 UTSW 9 78710239 missense probably damaging 1.00
R5440:Cd109 UTSW 9 78680164 critical splice donor site probably null
R5559:Cd109 UTSW 9 78660968 missense probably benign 0.01
R5701:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R5995:Cd109 UTSW 9 78700279 missense probably benign 0.01
R5997:Cd109 UTSW 9 78705062 missense possibly damaging 0.93
R6103:Cd109 UTSW 9 78698314 splice site probably null
R6174:Cd109 UTSW 9 78665546 critical splice donor site probably null
R6410:Cd109 UTSW 9 78657516 missense probably benign 0.01
R6529:Cd109 UTSW 9 78712625 missense probably damaging 1.00
R6655:Cd109 UTSW 9 78684938 missense probably benign 0.44
R6704:Cd109 UTSW 9 78680075 missense probably benign 0.01
R6772:Cd109 UTSW 9 78680810 missense possibly damaging 0.55
R6817:Cd109 UTSW 9 78714955 missense probably benign 0.01
R6903:Cd109 UTSW 9 78636603 missense probably damaging 0.97
R7294:Cd109 UTSW 9 78712635 missense probably damaging 0.97
R7432:Cd109 UTSW 9 78714943 missense possibly damaging 0.85
R7566:Cd109 UTSW 9 78680837 missense probably damaging 1.00
R7767:Cd109 UTSW 9 78710159 missense probably damaging 1.00
R8019:Cd109 UTSW 9 78707546 missense possibly damaging 0.81
R8050:Cd109 UTSW 9 78664351 missense probably benign 0.28
RF002:Cd109 UTSW 9 78712523 critical splice acceptor site probably benign
RF002:Cd109 UTSW 9 78712528 critical splice acceptor site probably benign
RF003:Cd109 UTSW 9 78712531 critical splice acceptor site probably benign
RF011:Cd109 UTSW 9 78712528 critical splice acceptor site probably benign
RF013:Cd109 UTSW 9 78712531 critical splice acceptor site probably benign
RF047:Cd109 UTSW 9 78712527 critical splice acceptor site probably benign
RF060:Cd109 UTSW 9 78712525 critical splice acceptor site probably benign
Z1177:Cd109 UTSW 9 78691313 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCCTTTAGTAGACGGGGAC -3'
(R):5'- AAATGCCTGCCTTGATTCCC -3'

Sequencing Primer
(F):5'- GGGGACTAAGAACCATTCCTCTG -3'
(R):5'- GCCTTGATTCCCAAAGTCTTAGAAAC -3'
Posted On2015-03-25