Incidental Mutation 'R3773:Matk'
ID273445
Institutional Source Beutler Lab
Gene Symbol Matk
Ensembl Gene ENSMUSG00000004933
Gene Namemegakaryocyte-associated tyrosine kinase
SynonymsCHK, Csk homologous kinase, Ntk, HYL
MMRRC Submission 040749-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3773 (G1)
Quality Score224
Status Not validated
Chromosome10
Chromosomal Location81252935-81263365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81258297 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 21 (L21Q)
Ref Sequence ENSEMBL: ENSMUSP00000113221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105328] [ENSMUST00000117488] [ENSMUST00000119547] [ENSMUST00000120265] [ENSMUST00000121205] [ENSMUST00000128576] [ENSMUST00000130282]
Predicted Effect probably benign
Transcript: ENSMUST00000105328
SMART Domains Protein: ENSMUSP00000100965
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
SH2 78 160 4.87e-31 SMART
TyrKc 193 436 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117488
AA Change: L21Q

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113221
Gene: ENSMUSG00000004933
AA Change: L21Q

DomainStartEndE-ValueType
SH3 49 107 1.37e-5 SMART
SH2 118 200 4.87e-31 SMART
TyrKc 233 476 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119547
SMART Domains Protein: ENSMUSP00000113576
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
SH2 78 160 4.87e-31 SMART
TyrKc 193 436 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120265
SMART Domains Protein: ENSMUSP00000113666
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 4.87e-31 SMART
TyrKc 194 437 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121205
SMART Domains Protein: ENSMUSP00000113043
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 4.87e-31 SMART
TyrKc 194 437 2.88e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126720
Predicted Effect probably benign
Transcript: ENSMUST00000128576
SMART Domains Protein: ENSMUSP00000122445
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 1.55e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130282
SMART Domains Protein: ENSMUSP00000114233
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
PDB:1JWO|A 75 101 1e-12 PDB
Blast:SH2 78 101 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151660
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has amino acid sequence similarity to Csk tyrosine kinase and has the structural features of the CSK subfamily: SRC homology SH2 and SH3 domains, a catalytic domain, a unique N terminus, lack of myristylation signals, lack of a negative regulatory phosphorylation site, and lack of an autophosphorylation site. This protein is thought to play a significant role in the signal transduction of hematopoietic cells. It is able to phosphorylate and inactivate Src family kinases, and may play an inhibitory role in the control of T-cell proliferation. This protein might be involved in signaling in some cases of breast cancer. Three alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice are viable and fertile and appear normal. Unchallenged mutant mice exhibit no hematopoietic defects. SPKLS cell numbers are elevated. IL-7 induced BM cell proliferation and pre-B cell colony formation are enhanced. Antigen induced IFN-gamma secretion is reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,876,262 M1T probably null Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
A2ml1 T A 6: 128,555,083 K899N probably benign Het
Adgrv1 G A 13: 81,499,043 S3126L probably damaging Het
Apba3 C A 10: 81,272,609 probably null Het
Apobec4 G T 1: 152,756,805 A195S probably benign Het
Asap3 C T 4: 136,227,575 T72I probably benign Het
BC067074 A G 13: 113,318,209 E263G probably benign Het
Cand2 T A 6: 115,785,217 H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Csgalnact2 T C 6: 118,126,219 K19E probably benign Het
Cyp17a1 T G 19: 46,669,723 K250T probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dgcr8 T C 16: 18,256,775 D712G probably damaging Het
Dsg2 T C 18: 20,591,862 W442R probably damaging Het
Elavl2 C T 4: 91,264,088 G131R probably damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Ercc6l2 A G 13: 63,841,450 D270G probably damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Fry A T 5: 150,398,198 R999S probably damaging Het
Gak G A 5: 108,582,672 T956I probably benign Het
Gm6614 T C 6: 141,972,335 K605R probably benign Het
Gm9008 C T 6: 76,496,959 V225I probably benign Het
Gps2 T C 11: 69,916,101 F21L probably damaging Het
Grhl3 C T 4: 135,555,847 W303* probably null Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Mthfr T C 4: 148,044,450 V160A probably benign Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Olfr1497 T A 19: 13,795,204 M136L probably benign Het
Olfr345 A T 2: 36,640,321 Y94F probably benign Het
Olfr57 G A 10: 79,035,180 C128Y possibly damaging Het
Olfr90 G T 17: 37,086,065 Y33* probably null Het
Pcdhb15 T A 18: 37,475,890 V725D probably benign Het
Pes1 A G 11: 3,975,548 Y221C probably damaging Het
Prkd3 T C 17: 78,959,106 I603V possibly damaging Het
Ptpn13 A G 5: 103,477,121 E97G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rims1 T C 1: 22,421,810 D842G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rngtt T C 4: 33,330,889 I164T probably damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Stxbp5 G A 10: 9,768,927 T960I probably damaging Het
Suco A T 1: 161,843,996 probably null Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tmem131l A G 3: 83,898,586 S1517P probably damaging Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Tsg101 T C 7: 46,889,615 *254W probably null Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Upb1 T A 10: 75,439,838 probably null Het
Vmn1r32 T A 6: 66,553,367 I142F probably benign Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 T C 15: 88,780,847 S373P probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp423 A T 8: 87,780,512 L1047Q probably benign Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Matk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Matk APN 10 81258294 missense probably benign
R0153:Matk UTSW 10 81262842 missense probably benign 0.01
R0243:Matk UTSW 10 81258492 missense probably benign 0.03
R0349:Matk UTSW 10 81258494 missense probably benign
R0462:Matk UTSW 10 81259693 missense probably damaging 1.00
R0562:Matk UTSW 10 81259691 missense probably benign 0.26
R0732:Matk UTSW 10 81258306 critical splice donor site probably null
R2356:Matk UTSW 10 81261543 critical splice donor site probably null
R4420:Matk UTSW 10 81262457 missense possibly damaging 0.63
R4855:Matk UTSW 10 81262886 unclassified probably benign
R5873:Matk UTSW 10 81260129 missense probably benign 0.10
R5906:Matk UTSW 10 81260919 missense probably damaging 1.00
R6209:Matk UTSW 10 81259588 missense probably damaging 1.00
R8308:Matk UTSW 10 81258287 missense probably benign 0.03
R8462:Matk UTSW 10 81262025 missense probably damaging 1.00
R8558:Matk UTSW 10 81260931 missense probably benign 0.00
R8782:Matk UTSW 10 81262460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCAGATTCCCAGGAATGAC -3'
(R):5'- CTGTGAAGGAAGGCAGTGTC -3'

Sequencing Primer
(F):5'- ACCTTGAGTCACGGCCC -3'
(R):5'- AAGGCAGTGTCATGCTGG -3'
Posted On2015-03-25