Incidental Mutation 'R3773:Apba3'
ID273446
Institutional Source Beutler Lab
Gene Symbol Apba3
Ensembl Gene ENSMUSG00000004931
Gene Nameamyloid beta (A4) precursor protein-binding, family A, member 3
SynonymsX11gamma, neuronal munc18-1-interacting protein 3, Mint 3, neuron-specific X11L2 protein, Mint-3, lin-10
MMRRC Submission 040749-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.542) question?
Stock #R3773 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location81266960-81273246 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 81272609 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000045744] [ENSMUST00000057798] [ENSMUST00000218742] [ENSMUST00000219304] [ENSMUST00000219460] [ENSMUST00000219479] [ENSMUST00000220297]
Predicted Effect probably benign
Transcript: ENSMUST00000045744
SMART Domains Protein: ENSMUSP00000036438
Gene: ENSMUSG00000034917

DomainStartEndE-ValueType
PDZ 20 93 2.81e-18 SMART
low complexity region 119 162 N/A INTRINSIC
PDZ 196 264 2.71e-11 SMART
low complexity region 297 305 N/A INTRINSIC
PDZ 378 451 4.97e-19 SMART
SH3 466 539 9.96e-2 SMART
low complexity region 548 559 N/A INTRINSIC
GuKc 570 756 6.9e-46 SMART
Blast:GuKc 767 898 9e-27 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000057798
AA Change: T471K

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050995
Gene: ENSMUSG00000004931
AA Change: T471K

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
PTB 213 359 3.03e-40 SMART
PDZ 400 478 3.74e-14 SMART
PDZ 492 557 9.58e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218146
Predicted Effect probably null
Transcript: ENSMUST00000218297
Predicted Effect probably benign
Transcript: ENSMUST00000218742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219294
Predicted Effect probably benign
Transcript: ENSMUST00000219304
Predicted Effect probably benign
Transcript: ENSMUST00000219460
Predicted Effect probably benign
Transcript: ENSMUST00000219479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219919
Predicted Effect possibly damaging
Transcript: ENSMUST00000220297
AA Change: T471K

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is an adapter protein that interacts with the Alzheimer's disease amyloid precursor protein. This gene product is believed to be involved in signal transduction processes. This gene is a candidate gene for Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion in mutants causes abnormalities in colon morphology and physiology, increased circulating blood urea nitrogen, and decreased serum chloride, sodium and potassium levels. Surviving homozygotes display diarrhea, postnatal viability and decreased life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,876,262 M1T probably null Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
A2ml1 T A 6: 128,555,083 K899N probably benign Het
Adgrv1 G A 13: 81,499,043 S3126L probably damaging Het
Apobec4 G T 1: 152,756,805 A195S probably benign Het
Asap3 C T 4: 136,227,575 T72I probably benign Het
BC067074 A G 13: 113,318,209 E263G probably benign Het
Cand2 T A 6: 115,785,217 H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Csgalnact2 T C 6: 118,126,219 K19E probably benign Het
Cyp17a1 T G 19: 46,669,723 K250T probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dgcr8 T C 16: 18,256,775 D712G probably damaging Het
Dsg2 T C 18: 20,591,862 W442R probably damaging Het
Elavl2 C T 4: 91,264,088 G131R probably damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Ercc6l2 A G 13: 63,841,450 D270G probably damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Fry A T 5: 150,398,198 R999S probably damaging Het
Gak G A 5: 108,582,672 T956I probably benign Het
Gm6614 T C 6: 141,972,335 K605R probably benign Het
Gm9008 C T 6: 76,496,959 V225I probably benign Het
Gps2 T C 11: 69,916,101 F21L probably damaging Het
Grhl3 C T 4: 135,555,847 W303* probably null Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Matk T A 10: 81,258,297 L21Q probably benign Het
Mthfr T C 4: 148,044,450 V160A probably benign Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Olfr1497 T A 19: 13,795,204 M136L probably benign Het
Olfr345 A T 2: 36,640,321 Y94F probably benign Het
Olfr57 G A 10: 79,035,180 C128Y possibly damaging Het
Olfr90 G T 17: 37,086,065 Y33* probably null Het
Pcdhb15 T A 18: 37,475,890 V725D probably benign Het
Pes1 A G 11: 3,975,548 Y221C probably damaging Het
Prkd3 T C 17: 78,959,106 I603V possibly damaging Het
Ptpn13 A G 5: 103,477,121 E97G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rims1 T C 1: 22,421,810 D842G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rngtt T C 4: 33,330,889 I164T probably damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Stxbp5 G A 10: 9,768,927 T960I probably damaging Het
Suco A T 1: 161,843,996 probably null Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tmem131l A G 3: 83,898,586 S1517P probably damaging Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Tsg101 T C 7: 46,889,615 *254W probably null Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Upb1 T A 10: 75,439,838 probably null Het
Vmn1r32 T A 6: 66,553,367 I142F probably benign Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 T C 15: 88,780,847 S373P probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp423 A T 8: 87,780,512 L1047Q probably benign Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Apba3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Apba3 APN 10 81273067 missense probably damaging 1.00
IGL00332:Apba3 APN 10 81273067 missense probably damaging 1.00
IGL01577:Apba3 APN 10 81272219 missense probably damaging 1.00
IGL01924:Apba3 APN 10 81273073 missense probably benign 0.01
IGL02655:Apba3 APN 10 81272954 missense probably benign 0.20
IGL03163:Apba3 APN 10 81269223 splice site probably null
R1381:Apba3 UTSW 10 81271756 missense possibly damaging 0.76
R2073:Apba3 UTSW 10 81269294 missense probably benign
R2114:Apba3 UTSW 10 81273112 missense probably damaging 1.00
R2196:Apba3 UTSW 10 81271708 missense probably damaging 1.00
R4895:Apba3 UTSW 10 81271283 critical splice donor site probably null
R4936:Apba3 UTSW 10 81269370 splice site probably null
R6576:Apba3 UTSW 10 81273091 missense probably benign 0.04
R7141:Apba3 UTSW 10 81273055 missense probably damaging 1.00
R7305:Apba3 UTSW 10 81271233 missense probably damaging 1.00
R7498:Apba3 UTSW 10 81268901 missense possibly damaging 0.55
R7599:Apba3 UTSW 10 81272346 missense probably damaging 0.99
R8399:Apba3 UTSW 10 81268998 missense probably benign 0.21
R8791:Apba3 UTSW 10 81269270 missense probably benign 0.00
X0020:Apba3 UTSW 10 81271049 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGTAGGGTGCATAGGAG -3'
(R):5'- AGCAGGCTACAAATCTGAGG -3'

Sequencing Primer
(F):5'- GAGCCCATTAACAGGGTCTC -3'
(R):5'- CAGCCTCACGATTCCAT -3'
Posted On2015-03-25