Incidental Mutation 'R3773:Gps2'
ID273448
Institutional Source Beutler Lab
Gene Symbol Gps2
Ensembl Gene ENSMUSG00000023170
Gene NameG protein pathway suppressor 2
SynonymsAMF-1
MMRRC Submission 040749-MU
Accession Numbers

Ncbi RefSeq: NM_019726.3; MGI:1891751

Is this an essential gene? Probably essential (E-score: 0.822) question?
Stock #R3773 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69913888-69916591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69916101 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 21 (F21L)
Ref Sequence ENSEMBL: ENSMUSP00000136921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043419] [ENSMUST00000057884] [ENSMUST00000061837] [ENSMUST00000070996] [ENSMUST00000071026] [ENSMUST00000072581] [ENSMUST00000108607] [ENSMUST00000108608] [ENSMUST00000108609] [ENSMUST00000108610] [ENSMUST00000108611] [ENSMUST00000108612] [ENSMUST00000108613] [ENSMUST00000108617] [ENSMUST00000116358] [ENSMUST00000133203] [ENSMUST00000134581] [ENSMUST00000152589] [ENSMUST00000153652] [ENSMUST00000164359] [ENSMUST00000177138] [ENSMUST00000177476]
Predicted Effect probably benign
Transcript: ENSMUST00000043419
SMART Domains Protein: ENSMUSP00000047008
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
eIF-5a 83 150 2.43e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000057884
AA Change: F265L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054072
Gene: ENSMUSG00000023170
AA Change: F265L

DomainStartEndE-ValueType
Pfam:G_path_suppress 5 294 6.1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061837
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070996
SMART Domains Protein: ENSMUSP00000067077
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071026
SMART Domains Protein: ENSMUSP00000068651
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000072581
AA Change: F265L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072389
Gene: ENSMUSG00000023170
AA Change: F265L

DomainStartEndE-ValueType
SCOP:d1jjva_ 22 83 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108607
SMART Domains Protein: ENSMUSP00000104247
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108608
SMART Domains Protein: ENSMUSP00000104248
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108609
SMART Domains Protein: ENSMUSP00000104249
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108610
SMART Domains Protein: ENSMUSP00000104250
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108611
SMART Domains Protein: ENSMUSP00000104251
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108612
SMART Domains Protein: ENSMUSP00000104252
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108613
SMART Domains Protein: ENSMUSP00000104253
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108617
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000116358
AA Change: F265L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112062
Gene: ENSMUSG00000023170
AA Change: F265L

DomainStartEndE-ValueType
SCOP:d1jjva_ 22 83 9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124596
Predicted Effect probably benign
Transcript: ENSMUST00000132183
SMART Domains Protein: ENSMUSP00000118868
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 161 172 N/A INTRINSIC
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133203
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134581
AA Change: F21L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000152589
SMART Domains Protein: ENSMUSP00000123402
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 2e-39 SMART
Pfam:eIF-5a 83 149 6.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153652
SMART Domains Protein: ENSMUSP00000137459
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
Pfam:eIF-5a 5 72 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164359
SMART Domains Protein: ENSMUSP00000132717
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177138
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177476
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in G protein-mitogen-activated protein kinase (MAPK) signaling cascades. When overexpressed in mammalian cells, this gene could potently suppress a RAS- and MAPK-mediated signal and interfere with JNK activity, suggesting that the function of this gene may be signal repression. The encoded protein is an integral subunit of the NCOR1-HDAC3 (nuclear receptor corepressor 1-histone deacetylase 3) complex, and it was shown that the complex inhibits JNK activation through this subunit and thus could potentially provide an alternative mechanism for hormone-mediated antagonism of AP1 (activator protein 1) function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,876,262 M1T probably null Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
A2ml1 T A 6: 128,555,083 K899N probably benign Het
Adgrv1 G A 13: 81,499,043 S3126L probably damaging Het
Apba3 C A 10: 81,272,609 probably null Het
Apobec4 G T 1: 152,756,805 A195S probably benign Het
Asap3 C T 4: 136,227,575 T72I probably benign Het
BC067074 A G 13: 113,318,209 E263G probably benign Het
Cand2 T A 6: 115,785,217 H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Csgalnact2 T C 6: 118,126,219 K19E probably benign Het
Cyp17a1 T G 19: 46,669,723 K250T probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dgcr8 T C 16: 18,256,775 D712G probably damaging Het
Dsg2 T C 18: 20,591,862 W442R probably damaging Het
Elavl2 C T 4: 91,264,088 G131R probably damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Ercc6l2 A G 13: 63,841,450 D270G probably damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Fry A T 5: 150,398,198 R999S probably damaging Het
Gak G A 5: 108,582,672 T956I probably benign Het
Gm6614 T C 6: 141,972,335 K605R probably benign Het
Gm9008 C T 6: 76,496,959 V225I probably benign Het
Grhl3 C T 4: 135,555,847 W303* probably null Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Matk T A 10: 81,258,297 L21Q probably benign Het
Mthfr T C 4: 148,044,450 V160A probably benign Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Olfr1497 T A 19: 13,795,204 M136L probably benign Het
Olfr345 A T 2: 36,640,321 Y94F probably benign Het
Olfr57 G A 10: 79,035,180 C128Y possibly damaging Het
Olfr90 G T 17: 37,086,065 Y33* probably null Het
Pcdhb15 T A 18: 37,475,890 V725D probably benign Het
Pes1 A G 11: 3,975,548 Y221C probably damaging Het
Prkd3 T C 17: 78,959,106 I603V possibly damaging Het
Ptpn13 A G 5: 103,477,121 E97G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rims1 T C 1: 22,421,810 D842G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rngtt T C 4: 33,330,889 I164T probably damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Stxbp5 G A 10: 9,768,927 T960I probably damaging Het
Suco A T 1: 161,843,996 probably null Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tmem131l A G 3: 83,898,586 S1517P probably damaging Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Tsg101 T C 7: 46,889,615 *254W probably null Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Upb1 T A 10: 75,439,838 probably null Het
Vmn1r32 T A 6: 66,553,367 I142F probably benign Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 T C 15: 88,780,847 S373P probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp423 A T 8: 87,780,512 L1047Q probably benign Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Gps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0067:Gps2 UTSW 11 69914781 nonsense probably null
R0067:Gps2 UTSW 11 69914781 nonsense probably null
R1086:Gps2 UTSW 11 69915224 unclassified probably benign
R1109:Gps2 UTSW 11 69915681 missense possibly damaging 0.94
R1938:Gps2 UTSW 11 69915369 missense probably benign
R1964:Gps2 UTSW 11 69916420 missense probably benign 0.03
R2355:Gps2 UTSW 11 69915381 frame shift probably null
R4765:Gps2 UTSW 11 69916361 unclassified probably benign
R4811:Gps2 UTSW 11 69915928 missense probably damaging 0.99
R5119:Gps2 UTSW 11 69914791 missense probably benign 0.00
R5183:Gps2 UTSW 11 69915197 missense probably benign 0.00
R5218:Gps2 UTSW 11 69916295 critical splice donor site probably null
R5965:Gps2 UTSW 11 69914794 missense possibly damaging 0.60
R7172:Gps2 UTSW 11 69916436 missense probably benign 0.40
R7562:Gps2 UTSW 11 69916482 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CAGTGCATGGCCACTTTCAG -3'
(R):5'- GTATATGTAGGTTTGATTGCCAGCC -3'

Sequencing Primer
(F):5'- TTTCAGCCCACTCAGACAGGTG -3'
(R):5'- GTAGGTTTGATTGCCAGCCTTACC -3'
Posted On2015-03-25