Mutagenetix > Incidental Mutations

Incidental Mutation 'R3773:Trio'

273457

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

040749-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3773 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27748091 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 2492 (S2492P)

Ref Sequence

ENSEMBL: ENSMUSP00000087714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000090247
AA Change: S2492P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: S2492P

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226644
AA Change: S1348P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000226713

Predicted Effect

unknown
Transcript: ENSMUST00000227030
AA Change: L48P

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227642

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228084

Meta Mutation Damage Score

0.0720

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	C	17: 56,876,262	M1T	probably null	Het
1810041L15Rik	A	T	15: 84,406,685	Y120*	probably null	Het
A2ml1	T	A	6: 128,555,083	K899N	probably benign	Het
Adgrv1	G	A	13: 81,499,043	S3126L	probably damaging	Het
Apba3	C	A	10: 81,272,609		probably null	Het
Apobec4	G	T	1: 152,756,805	A195S	probably benign	Het
Asap3	C	T	4: 136,227,575	T72I	probably benign	Het
BC067074	A	G	13: 113,318,209	E263G	probably benign	Het
Cand2	T	A	6: 115,785,217	H201Q	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Chd1	A	G	17: 17,374,651	D16G	probably damaging	Het
Csgalnact2	T	C	6: 118,126,219	K19E	probably benign	Het
Cyp17a1	T	G	19: 46,669,723	K250T	probably damaging	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Dgcr8	T	C	16: 18,256,775	D712G	probably damaging	Het
Dsg2	T	C	18: 20,591,862	W442R	probably damaging	Het
Elavl2	C	T	4: 91,264,088	G131R	probably damaging	Het
Elf1	T	C	14: 79,567,210	V105A	possibly damaging	Het
Ercc6l2	A	G	13: 63,841,450	D270G	probably damaging	Het
Fmn1	T	G	2: 113,582,118	S996A	probably damaging	Het
Frmd4a	A	T	2: 4,590,622	E109D	probably damaging	Het
Fry	A	T	5: 150,398,198	R999S	probably damaging	Het
Gak	G	A	5: 108,582,672	T956I	probably benign	Het
Gm6614	T	C	6: 141,972,335	K605R	probably benign	Het
Gm9008	C	T	6: 76,496,959	V225I	probably benign	Het
Gps2	T	C	11: 69,916,101	F21L	probably damaging	Het
Grhl3	C	T	4: 135,555,847	W303*	probably null	Het
Hmcn2	C	T	2: 31,360,896	T790M	probably damaging	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Matk	T	A	10: 81,258,297	L21Q	probably benign	Het
Mthfr	T	C	4: 148,044,450	V160A	probably benign	Het
Nhlrc4	T	A	17: 25,943,393	K127*	probably null	Het
Nsd1	G	A	13: 55,246,673	V696I	probably benign	Het
Nup210l	T	G	3: 90,119,894	Y194*	probably null	Het
Olfr1497	T	A	19: 13,795,204	M136L	probably benign	Het
Olfr345	A	T	2: 36,640,321	Y94F	probably benign	Het
Olfr57	G	A	10: 79,035,180	C128Y	possibly damaging	Het
Olfr90	G	T	17: 37,086,065	Y33*	probably null	Het
Pcdhb15	T	A	18: 37,475,890	V725D	probably benign	Het
Pes1	A	G	11: 3,975,548	Y221C	probably damaging	Het
Prkd3	T	C	17: 78,959,106	I603V	possibly damaging	Het
Ptpn13	A	G	5: 103,477,121	E97G	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ptprs	T	C	17: 56,428,978	T152A	possibly damaging	Het
Rims1	T	C	1: 22,421,810	D842G	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rngtt	T	C	4: 33,330,889	I164T	probably damaging	Het
Scn9a	T	C	2: 66,483,648	N1909D	probably benign	Het
Ska3	C	T	14: 57,810,077	V334I	probably benign	Het
Srebf2	A	G	15: 82,182,108	K579R	probably benign	Het
Stxbp5	G	A	10: 9,768,927	T960I	probably damaging	Het
Suco	A	T	1: 161,843,996		probably null	Het
Tecta	T	C	9: 42,330,996	T2094A	probably damaging	Het
Tenm4	A	T	7: 96,694,880	R227W	probably damaging	Het
Tmem131l	A	G	3: 83,898,586	S1517P	probably damaging	Het
Tsg101	T	C	7: 46,889,615	*254W	probably null	Het
Ttn	T	C	2: 76,771,367	T16872A	probably benign	Het
Ugt2b38	A	G	5: 87,424,095	V26A	probably damaging	Het
Upb1	T	A	10: 75,439,838		probably null	Het
Vmn1r32	T	A	6: 66,553,367	I142F	probably benign	Het
Vmn1r60	C	A	7: 5,544,711	C130F	possibly damaging	Het
Vmn2r101	A	G	17: 19,589,657	D235G	probably benign	Het
Wnk1	C	T	6: 120,002,280	R282Q	possibly damaging	Het
Xrn2	T	C	2: 147,061,287	V765A	probably benign	Het
Zbed4	T	C	15: 88,780,847	S373P	probably benign	Het
Zfp251	A	G	15: 76,853,636	I414T	possibly damaging	Het
Zfp423	A	T	8: 87,780,512	L1047Q	probably benign	Het
Zfp426	A	T	9: 20,473,117		probably null	Het
Zfp61	T	C	7: 24,295,981	M1V	probably null	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27744146	splice site	probably null
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27773952	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27901200	missense	probably benign	0.25
R8682:Trio	UTSW	15	27905192	missense	unknown
R8688:Trio	UTSW	15	27748238	missense	possibly damaging	0.61
R8708:Trio	UTSW	15	27732546	missense	probably damaging	0.99
R8709:Trio	UTSW	15	27919237	missense	unknown
R8713:Trio	UTSW	15	27743951	critical splice donor site	probably benign
R8798:Trio	UTSW	15	27851837	missense	possibly damaging	0.92
R8812:Trio	UTSW	15	27905225	missense	unknown
R8816:Trio	UTSW	15	27741271	missense	probably damaging	0.96
R8828:Trio	UTSW	15	27741064	missense	possibly damaging	0.93
R8987:Trio	UTSW	15	27732687	missense	probably benign	0.23
R9051:Trio	UTSW	15	27732684	missense	possibly damaging	0.78
R9069:Trio	UTSW	15	27852011	missense	possibly damaging	0.83
R9075:Trio	UTSW	15	27773936	nonsense	probably null
R9079:Trio	UTSW	15	27732937	missense	possibly damaging	0.52
R9139:Trio	UTSW	15	27749836	nonsense	probably null
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGCTCTGAGTGGACTGCAC -3'
(R):5'- ATTCCCAAGATGAAGGTGATGG -3'

Sequencing Primer
(F):5'- TGAGTGGACTGCACGGACTG -3'
(R):5'- TTCCGGTACAAGCCAAGACGG -3'

Posted On

2015-03-25