Incidental Mutation 'R3773:Vmn2r101'
ID273466
Institutional Source Beutler Lab
Gene Symbol Vmn2r101
Ensembl Gene ENSMUSG00000094892
Gene Namevomeronasal 2, receptor 101
SynonymsEG627576
MMRRC Submission 040749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R3773 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location19577231-19612317 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19589657 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 235 (D235G)
Ref Sequence ENSEMBL: ENSMUSP00000131583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171914]
Predicted Effect probably benign
Transcript: ENSMUST00000171914
AA Change: D235G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131583
Gene: ENSMUSG00000094892
AA Change: D235G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 466 1.6e-36 PFAM
Pfam:NCD3G 509 562 6.4e-22 PFAM
Pfam:7tm_3 595 830 1.4e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,876,262 M1T probably null Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
A2ml1 T A 6: 128,555,083 K899N probably benign Het
Adgrv1 G A 13: 81,499,043 S3126L probably damaging Het
Apba3 C A 10: 81,272,609 probably null Het
Apobec4 G T 1: 152,756,805 A195S probably benign Het
Asap3 C T 4: 136,227,575 T72I probably benign Het
BC067074 A G 13: 113,318,209 E263G probably benign Het
Cand2 T A 6: 115,785,217 H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Csgalnact2 T C 6: 118,126,219 K19E probably benign Het
Cyp17a1 T G 19: 46,669,723 K250T probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dgcr8 T C 16: 18,256,775 D712G probably damaging Het
Dsg2 T C 18: 20,591,862 W442R probably damaging Het
Elavl2 C T 4: 91,264,088 G131R probably damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Ercc6l2 A G 13: 63,841,450 D270G probably damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Fry A T 5: 150,398,198 R999S probably damaging Het
Gak G A 5: 108,582,672 T956I probably benign Het
Gm6614 T C 6: 141,972,335 K605R probably benign Het
Gm9008 C T 6: 76,496,959 V225I probably benign Het
Gps2 T C 11: 69,916,101 F21L probably damaging Het
Grhl3 C T 4: 135,555,847 W303* probably null Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Matk T A 10: 81,258,297 L21Q probably benign Het
Mthfr T C 4: 148,044,450 V160A probably benign Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Olfr1497 T A 19: 13,795,204 M136L probably benign Het
Olfr345 A T 2: 36,640,321 Y94F probably benign Het
Olfr57 G A 10: 79,035,180 C128Y possibly damaging Het
Olfr90 G T 17: 37,086,065 Y33* probably null Het
Pcdhb15 T A 18: 37,475,890 V725D probably benign Het
Pes1 A G 11: 3,975,548 Y221C probably damaging Het
Prkd3 T C 17: 78,959,106 I603V possibly damaging Het
Ptpn13 A G 5: 103,477,121 E97G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rims1 T C 1: 22,421,810 D842G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rngtt T C 4: 33,330,889 I164T probably damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Stxbp5 G A 10: 9,768,927 T960I probably damaging Het
Suco A T 1: 161,843,996 probably null Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tmem131l A G 3: 83,898,586 S1517P probably damaging Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Tsg101 T C 7: 46,889,615 *254W probably null Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Upb1 T A 10: 75,439,838 probably null Het
Vmn1r32 T A 6: 66,553,367 I142F probably benign Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 T C 15: 88,780,847 S373P probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp423 A T 8: 87,780,512 L1047Q probably benign Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Vmn2r101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Vmn2r101 APN 17 19589674 missense probably damaging 0.99
IGL02125:Vmn2r101 APN 17 19589701 missense possibly damaging 0.95
IGL02300:Vmn2r101 APN 17 19611937 missense probably damaging 1.00
IGL02682:Vmn2r101 APN 17 19612245 missense possibly damaging 0.82
IGL02825:Vmn2r101 APN 17 19589870 missense probably benign 0.00
IGL02862:Vmn2r101 APN 17 19611605 missense probably damaging 1.00
IGL02943:Vmn2r101 APN 17 19611404 missense probably damaging 0.99
R0371:Vmn2r101 UTSW 17 19590132 missense probably benign 0.07
R0462:Vmn2r101 UTSW 17 19590169 missense probably benign 0.04
R0492:Vmn2r101 UTSW 17 19588983 missense probably damaging 1.00
R0654:Vmn2r101 UTSW 17 19590111 missense probably benign 0.01
R1120:Vmn2r101 UTSW 17 19577461 splice site probably benign
R1323:Vmn2r101 UTSW 17 19612051 missense probably damaging 1.00
R1323:Vmn2r101 UTSW 17 19612051 missense probably damaging 1.00
R1676:Vmn2r101 UTSW 17 19611922 missense probably benign 0.00
R2023:Vmn2r101 UTSW 17 19590106 nonsense probably null
R2149:Vmn2r101 UTSW 17 19588963 missense probably benign 0.00
R2350:Vmn2r101 UTSW 17 19589783 missense probably benign 0.01
R2760:Vmn2r101 UTSW 17 19589639 missense probably benign 0.14
R3085:Vmn2r101 UTSW 17 19588815 splice site probably null
R3086:Vmn2r101 UTSW 17 19588815 splice site probably null
R3719:Vmn2r101 UTSW 17 19589549 missense possibly damaging 0.50
R3771:Vmn2r101 UTSW 17 19589657 missense probably benign
R4225:Vmn2r101 UTSW 17 19611689 missense probably damaging 1.00
R4248:Vmn2r101 UTSW 17 19589114 missense probably damaging 1.00
R4290:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4291:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4293:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4307:Vmn2r101 UTSW 17 19590161 missense probably damaging 1.00
R4721:Vmn2r101 UTSW 17 19612025 missense probably damaging 0.99
R4829:Vmn2r101 UTSW 17 19611967 missense probably benign 0.03
R5022:Vmn2r101 UTSW 17 19611387 critical splice acceptor site probably null
R5110:Vmn2r101 UTSW 17 19611635 missense possibly damaging 0.92
R5244:Vmn2r101 UTSW 17 19611526 missense probably damaging 1.00
R5397:Vmn2r101 UTSW 17 19588842 missense probably damaging 1.00
R5875:Vmn2r101 UTSW 17 19588830 missense probably damaging 0.99
R5944:Vmn2r101 UTSW 17 19589507 missense probably benign 0.00
R6216:Vmn2r101 UTSW 17 19591005 missense probably benign 0.00
R6334:Vmn2r101 UTSW 17 19589850 missense possibly damaging 0.83
R6512:Vmn2r101 UTSW 17 19588884 missense probably damaging 1.00
R6607:Vmn2r101 UTSW 17 19612034 missense probably damaging 1.00
R6965:Vmn2r101 UTSW 17 19591022 missense probably benign 0.00
R7101:Vmn2r101 UTSW 17 19589088 missense probably null 0.14
R7183:Vmn2r101 UTSW 17 19612178 missense probably damaging 1.00
R7344:Vmn2r101 UTSW 17 19611797 missense probably benign 0.38
R7375:Vmn2r101 UTSW 17 19611390 missense probably damaging 1.00
R7574:Vmn2r101 UTSW 17 19611637 missense possibly damaging 0.91
R7575:Vmn2r101 UTSW 17 19611392 missense probably benign 0.01
R7592:Vmn2r101 UTSW 17 19591181 splice site probably null
R7626:Vmn2r101 UTSW 17 19611930 nonsense probably null
R7715:Vmn2r101 UTSW 17 19611915 missense probably damaging 1.00
R7730:Vmn2r101 UTSW 17 19611688 missense possibly damaging 0.81
Z1088:Vmn2r101 UTSW 17 19588975 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GATCCTTTATTAAGTGACCGTGATC -3'
(R):5'- GCTTCCATGGAATGAGTCTAACATG -3'

Sequencing Primer
(F):5'- AAGTGACCGTGATCAGTATCC -3'
(R):5'- GTCAGCTCTGTCAATAACATGGTG -3'
Posted On2015-03-25