Incidental Mutation 'R3773:Nhlrc4'
ID273467
Institutional Source Beutler Lab
Gene Symbol Nhlrc4
Ensembl Gene ENSMUSG00000090113
Gene NameNHL repeat containing 4
Synonyms
MMRRC Submission 040749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3773 (G1)
Quality Score164
Status Not validated
Chromosome17
Chromosomal Location25942233-25944961 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 25943393 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 127 (K127*)
Ref Sequence ENSEMBL: ENSMUSP00000082102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026823] [ENSMUST00000085027] [ENSMUST00000097368] [ENSMUST00000139226] [ENSMUST00000140304] [ENSMUST00000145745] [ENSMUST00000148307] [ENSMUST00000148382] [ENSMUST00000162431] [ENSMUST00000208043] [ENSMUST00000208071]
Predicted Effect probably benign
Transcript: ENSMUST00000026823
SMART Domains Protein: ENSMUSP00000026823
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 214 228 N/A INTRINSIC
Pfam:Gpi1 274 463 5.1e-79 PFAM
transmembrane domain 478 500 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085027
AA Change: K127*
SMART Domains Protein: ENSMUSP00000082102
Gene: ENSMUSG00000090113
AA Change: K127*

DomainStartEndE-ValueType
Pfam:NHL 61 88 8.4e-8 PFAM
SCOP:d1crua_ 89 129 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097368
SMART Domains Protein: ENSMUSP00000094981
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 214 228 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Pfam:Gpi1 365 523 8.6e-66 PFAM
transmembrane domain 538 560 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124032
Predicted Effect probably benign
Transcript: ENSMUST00000139226
SMART Domains Protein: ENSMUSP00000115447
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 214 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140304
Predicted Effect probably benign
Transcript: ENSMUST00000145745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148045
Predicted Effect probably benign
Transcript: ENSMUST00000148307
Predicted Effect probably benign
Transcript: ENSMUST00000148382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162078
Predicted Effect probably benign
Transcript: ENSMUST00000162431
SMART Domains Protein: ENSMUSP00000125106
Gene: ENSMUSG00000025727

DomainStartEndE-ValueType
Pfam:zf-C2H2_7 17 70 4.3e-40 PFAM
low complexity region 77 90 N/A INTRINSIC
low complexity region 117 137 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
low complexity region 229 249 N/A INTRINSIC
low complexity region 294 311 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Predicted Effect probably benign
Transcript: ENSMUST00000208043
Predicted Effect probably benign
Transcript: ENSMUST00000208071
Meta Mutation Damage Score 0.9567 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,876,262 M1T probably null Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
A2ml1 T A 6: 128,555,083 K899N probably benign Het
Adgrv1 G A 13: 81,499,043 S3126L probably damaging Het
Apba3 C A 10: 81,272,609 probably null Het
Apobec4 G T 1: 152,756,805 A195S probably benign Het
Asap3 C T 4: 136,227,575 T72I probably benign Het
BC067074 A G 13: 113,318,209 E263G probably benign Het
Cand2 T A 6: 115,785,217 H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Csgalnact2 T C 6: 118,126,219 K19E probably benign Het
Cyp17a1 T G 19: 46,669,723 K250T probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dgcr8 T C 16: 18,256,775 D712G probably damaging Het
Dsg2 T C 18: 20,591,862 W442R probably damaging Het
Elavl2 C T 4: 91,264,088 G131R probably damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Ercc6l2 A G 13: 63,841,450 D270G probably damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Fry A T 5: 150,398,198 R999S probably damaging Het
Gak G A 5: 108,582,672 T956I probably benign Het
Gm6614 T C 6: 141,972,335 K605R probably benign Het
Gm9008 C T 6: 76,496,959 V225I probably benign Het
Gps2 T C 11: 69,916,101 F21L probably damaging Het
Grhl3 C T 4: 135,555,847 W303* probably null Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Matk T A 10: 81,258,297 L21Q probably benign Het
Mthfr T C 4: 148,044,450 V160A probably benign Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Olfr1497 T A 19: 13,795,204 M136L probably benign Het
Olfr345 A T 2: 36,640,321 Y94F probably benign Het
Olfr57 G A 10: 79,035,180 C128Y possibly damaging Het
Olfr90 G T 17: 37,086,065 Y33* probably null Het
Pcdhb15 T A 18: 37,475,890 V725D probably benign Het
Pes1 A G 11: 3,975,548 Y221C probably damaging Het
Prkd3 T C 17: 78,959,106 I603V possibly damaging Het
Ptpn13 A G 5: 103,477,121 E97G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rims1 T C 1: 22,421,810 D842G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rngtt T C 4: 33,330,889 I164T probably damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Stxbp5 G A 10: 9,768,927 T960I probably damaging Het
Suco A T 1: 161,843,996 probably null Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tmem131l A G 3: 83,898,586 S1517P probably damaging Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Tsg101 T C 7: 46,889,615 *254W probably null Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Upb1 T A 10: 75,439,838 probably null Het
Vmn1r32 T A 6: 66,553,367 I142F probably benign Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 T C 15: 88,780,847 S373P probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp423 A T 8: 87,780,512 L1047Q probably benign Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Nhlrc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02343:Nhlrc4 APN 17 25943361 makesense probably null
R0690:Nhlrc4 UTSW 17 25943684 missense probably damaging 1.00
R3771:Nhlrc4 UTSW 17 25943393 nonsense probably null
R4740:Nhlrc4 UTSW 17 25943603 missense probably benign 0.28
R5598:Nhlrc4 UTSW 17 25943492 missense probably damaging 1.00
R5930:Nhlrc4 UTSW 17 25943719 missense probably benign 0.03
R6873:Nhlrc4 UTSW 17 25943522 nonsense probably null
Z1176:Nhlrc4 UTSW 17 25943744 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCACTTGCCAAGAGGAAATC -3'
(R):5'- TGACTGGGCATAACTTTGGC -3'

Sequencing Primer
(F):5'- TTGCCAAGAGGAAATCACAAAGC -3'
(R):5'- GGCATAACTTTGGCCACCCAG -3'
Posted On2015-03-25