Incidental Mutation 'R3773:Dsg2'
ID 273473
Institutional Source Beutler Lab
Gene Symbol Dsg2
Ensembl Gene ENSMUSG00000044393
Gene Name desmoglein 2
Synonyms D18Ertd293e
MMRRC Submission 040749-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.202) question?
Stock # R3773 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 20691131-20737578 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20724919 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 442 (W442R)
Ref Sequence ENSEMBL: ENSMUSP00000057096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059787]
AlphaFold O55111
Predicted Effect probably damaging
Transcript: ENSMUST00000059787
AA Change: W442R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: W442R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
CA 298 392 1.94e-8 SMART
CA 418 502 2.34e-16 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 822 838 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,532,046 (GRCm39) K899N probably benign Het
Acsbg3 T C 17: 57,183,262 (GRCm39) M1T probably null Het
Adgrv1 G A 13: 81,647,162 (GRCm39) S3126L probably damaging Het
Apba3 C A 10: 81,108,443 (GRCm39) probably null Het
Apobec4 G T 1: 152,632,556 (GRCm39) A195S probably benign Het
Asap3 C T 4: 135,954,886 (GRCm39) T72I probably benign Het
Cand2 T A 6: 115,762,178 (GRCm39) H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Chd1 A G 17: 17,594,913 (GRCm39) D16G probably damaging Het
Csgalnact2 T C 6: 118,103,180 (GRCm39) K19E probably benign Het
Cspg4b A G 13: 113,454,743 (GRCm39) E263G probably benign Het
Cyp17a1 T G 19: 46,658,162 (GRCm39) K250T probably damaging Het
Ddx41 G A 13: 55,682,293 (GRCm39) R205W possibly damaging Het
Dgcr8 T C 16: 18,074,639 (GRCm39) D712G probably damaging Het
Elavl2 C T 4: 91,152,325 (GRCm39) G131R probably damaging Het
Elf1 T C 14: 79,804,650 (GRCm39) V105A possibly damaging Het
Ercc6l2 A G 13: 63,989,264 (GRCm39) D270G probably damaging Het
Fmn1 T G 2: 113,412,463 (GRCm39) S996A probably damaging Het
Frmd4a A T 2: 4,595,433 (GRCm39) E109D probably damaging Het
Fry A T 5: 150,321,663 (GRCm39) R999S probably damaging Het
Gak G A 5: 108,730,538 (GRCm39) T956I probably benign Het
Gps2 T C 11: 69,806,927 (GRCm39) F21L probably damaging Het
Grhl3 C T 4: 135,283,158 (GRCm39) W303* probably null Het
Hmcn2 C T 2: 31,250,908 (GRCm39) T790M probably damaging Het
Lrp5 G A 19: 3,662,330 (GRCm39) R173C probably damaging Het
Matk T A 10: 81,094,131 (GRCm39) L21Q probably benign Het
Mthfr T C 4: 148,128,907 (GRCm39) V160A probably benign Het
Nhlrc4 T A 17: 26,162,367 (GRCm39) K127* probably null Het
Nsd1 G A 13: 55,394,486 (GRCm39) V696I probably benign Het
Nup210l T G 3: 90,027,201 (GRCm39) Y194* probably null Het
Or1j16 A T 2: 36,530,333 (GRCm39) Y94F probably benign Het
Or2h2 G T 17: 37,396,957 (GRCm39) Y33* probably null Het
Or7a41 G A 10: 78,871,014 (GRCm39) C128Y possibly damaging Het
Or9q2 T A 19: 13,772,568 (GRCm39) M136L probably benign Het
Pcdhb15 T A 18: 37,608,943 (GRCm39) V725D probably benign Het
Pes1 A G 11: 3,925,548 (GRCm39) Y221C probably damaging Het
Prkd3 T C 17: 79,266,535 (GRCm39) I603V possibly damaging Het
Ptpn13 A G 5: 103,624,987 (GRCm39) E97G probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Ptprs T C 17: 56,735,978 (GRCm39) T152A possibly damaging Het
Rims1 T C 1: 22,492,034 (GRCm39) D842G probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Rnf26rt C T 6: 76,473,942 (GRCm39) V225I probably benign Het
Rngtt T C 4: 33,330,889 (GRCm39) I164T probably damaging Het
Scn9a T C 2: 66,313,992 (GRCm39) N1909D probably benign Het
Shisal1 A T 15: 84,290,886 (GRCm39) Y120* probably null Het
Ska3 C T 14: 58,047,534 (GRCm39) V334I probably benign Het
Slco1a8 T C 6: 141,918,061 (GRCm39) K605R probably benign Het
Srebf2 A G 15: 82,066,309 (GRCm39) K579R probably benign Het
Stxbp5 G A 10: 9,644,671 (GRCm39) T960I probably damaging Het
Suco A T 1: 161,671,565 (GRCm39) probably null Het
Tecta T C 9: 42,242,292 (GRCm39) T2094A probably damaging Het
Tenm4 A T 7: 96,344,087 (GRCm39) R227W probably damaging Het
Tmem131l A G 3: 83,805,893 (GRCm39) S1517P probably damaging Het
Trio A G 15: 27,748,177 (GRCm39) S2492P probably damaging Het
Tsg101 T C 7: 46,539,363 (GRCm39) *254W probably null Het
Ttn T C 2: 76,601,711 (GRCm39) T16872A probably benign Het
Ugt2b38 A G 5: 87,571,954 (GRCm39) V26A probably damaging Het
Upb1 T A 10: 75,275,672 (GRCm39) probably null Het
Vmn1r32 T A 6: 66,530,351 (GRCm39) I142F probably benign Het
Vmn1r60 C A 7: 5,547,710 (GRCm39) C130F possibly damaging Het
Vmn2r101 A G 17: 19,809,919 (GRCm39) D235G probably benign Het
Wnk1 C T 6: 119,979,241 (GRCm39) R282Q possibly damaging Het
Xrn2 T C 2: 146,903,207 (GRCm39) V765A probably benign Het
Zbed4 T C 15: 88,665,050 (GRCm39) S373P probably benign Het
Zfp251 A G 15: 76,737,836 (GRCm39) I414T possibly damaging Het
Zfp423 A T 8: 88,507,140 (GRCm39) L1047Q probably benign Het
Zfp426 A T 9: 20,384,413 (GRCm39) probably null Het
Zfp61 T C 7: 23,995,406 (GRCm39) M1V probably null Het
Other mutations in Dsg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dsg2 APN 18 20,734,826 (GRCm39) missense probably benign 0.10
IGL00979:Dsg2 APN 18 20,715,824 (GRCm39) missense probably damaging 0.99
IGL01081:Dsg2 APN 18 20,722,999 (GRCm39) unclassified probably benign
IGL01358:Dsg2 APN 18 20,734,850 (GRCm39) missense probably damaging 0.98
IGL02002:Dsg2 APN 18 20,712,233 (GRCm39) missense probably damaging 1.00
IGL02263:Dsg2 APN 18 20,723,077 (GRCm39) missense possibly damaging 0.70
IGL02410:Dsg2 APN 18 20,735,189 (GRCm39) missense probably benign 0.04
IGL02553:Dsg2 APN 18 20,725,467 (GRCm39) missense probably damaging 1.00
IGL03036:Dsg2 APN 18 20,712,134 (GRCm39) missense probably damaging 0.99
dissolute UTSW 18 20,729,008 (GRCm39) splice site probably null
Dysjunction UTSW 18 20,715,996 (GRCm39) nonsense probably null
weg UTSW 18 20,713,708 (GRCm39) nonsense probably null
R0094:Dsg2 UTSW 18 20,724,910 (GRCm39) missense probably benign 0.08
R0094:Dsg2 UTSW 18 20,724,910 (GRCm39) missense probably benign 0.08
R0105:Dsg2 UTSW 18 20,735,111 (GRCm39) missense probably benign 0.03
R0105:Dsg2 UTSW 18 20,735,111 (GRCm39) missense probably benign 0.03
R0112:Dsg2 UTSW 18 20,716,099 (GRCm39) missense probably benign 0.02
R0305:Dsg2 UTSW 18 20,715,752 (GRCm39) splice site probably benign
R0380:Dsg2 UTSW 18 20,715,996 (GRCm39) nonsense probably null
R0401:Dsg2 UTSW 18 20,725,565 (GRCm39) splice site probably benign
R0421:Dsg2 UTSW 18 20,712,448 (GRCm39) missense probably damaging 1.00
R0578:Dsg2 UTSW 18 20,727,291 (GRCm39) missense probably benign 0.00
R0667:Dsg2 UTSW 18 20,706,556 (GRCm39) missense possibly damaging 0.50
R1223:Dsg2 UTSW 18 20,706,550 (GRCm39) missense probably benign 0.23
R1433:Dsg2 UTSW 18 20,715,780 (GRCm39) missense probably damaging 0.98
R1543:Dsg2 UTSW 18 20,727,268 (GRCm39) missense probably benign 0.33
R1730:Dsg2 UTSW 18 20,724,937 (GRCm39) missense probably benign 0.01
R1783:Dsg2 UTSW 18 20,724,937 (GRCm39) missense probably benign 0.01
R1946:Dsg2 UTSW 18 20,713,605 (GRCm39) missense probably damaging 1.00
R1991:Dsg2 UTSW 18 20,734,530 (GRCm39) missense probably damaging 1.00
R1992:Dsg2 UTSW 18 20,734,530 (GRCm39) missense probably damaging 1.00
R2027:Dsg2 UTSW 18 20,716,061 (GRCm39) unclassified probably benign
R2109:Dsg2 UTSW 18 20,725,346 (GRCm39) missense probably benign 0.00
R2143:Dsg2 UTSW 18 20,712,218 (GRCm39) missense probably damaging 1.00
R2201:Dsg2 UTSW 18 20,729,111 (GRCm39) missense probably damaging 1.00
R2343:Dsg2 UTSW 18 20,735,355 (GRCm39) missense probably damaging 0.99
R2937:Dsg2 UTSW 18 20,712,185 (GRCm39) missense probably damaging 1.00
R3710:Dsg2 UTSW 18 20,735,174 (GRCm39) missense probably damaging 1.00
R3734:Dsg2 UTSW 18 20,735,004 (GRCm39) missense probably benign 0.41
R4176:Dsg2 UTSW 18 20,713,720 (GRCm39) missense probably benign 0.25
R4213:Dsg2 UTSW 18 20,731,571 (GRCm39) missense probably benign 0.01
R4299:Dsg2 UTSW 18 20,729,008 (GRCm39) splice site probably null
R4515:Dsg2 UTSW 18 20,734,444 (GRCm39) missense probably benign
R4649:Dsg2 UTSW 18 20,735,302 (GRCm39) missense possibly damaging 0.56
R4940:Dsg2 UTSW 18 20,712,487 (GRCm39) missense probably damaging 1.00
R4949:Dsg2 UTSW 18 20,723,241 (GRCm39) missense probably damaging 1.00
R4998:Dsg2 UTSW 18 20,734,578 (GRCm39) missense probably benign 0.26
R5078:Dsg2 UTSW 18 20,729,140 (GRCm39) critical splice donor site probably null
R5155:Dsg2 UTSW 18 20,731,715 (GRCm39) missense possibly damaging 0.67
R5398:Dsg2 UTSW 18 20,712,190 (GRCm39) missense probably benign 0.45
R5503:Dsg2 UTSW 18 20,713,708 (GRCm39) nonsense probably null
R6133:Dsg2 UTSW 18 20,723,146 (GRCm39) missense probably benign 0.00
R6163:Dsg2 UTSW 18 20,731,726 (GRCm39) critical splice donor site probably null
R6226:Dsg2 UTSW 18 20,712,506 (GRCm39) missense probably damaging 0.98
R6228:Dsg2 UTSW 18 20,727,350 (GRCm39) critical splice donor site probably null
R6241:Dsg2 UTSW 18 20,723,274 (GRCm39) splice site probably null
R6482:Dsg2 UTSW 18 20,734,371 (GRCm39) missense possibly damaging 0.69
R6524:Dsg2 UTSW 18 20,716,093 (GRCm39) missense probably damaging 1.00
R6856:Dsg2 UTSW 18 20,734,859 (GRCm39) missense probably damaging 0.98
R7058:Dsg2 UTSW 18 20,725,332 (GRCm39) missense probably benign 0.00
R7108:Dsg2 UTSW 18 20,734,920 (GRCm39) missense probably damaging 1.00
R7149:Dsg2 UTSW 18 20,712,511 (GRCm39) missense probably damaging 0.98
R7207:Dsg2 UTSW 18 20,734,516 (GRCm39) missense probably damaging 0.99
R7256:Dsg2 UTSW 18 20,724,988 (GRCm39) missense possibly damaging 0.96
R7315:Dsg2 UTSW 18 20,712,217 (GRCm39) missense probably damaging 0.97
R7471:Dsg2 UTSW 18 20,713,675 (GRCm39) missense probably benign 0.08
R7558:Dsg2 UTSW 18 20,727,291 (GRCm39) missense probably benign 0.00
R8094:Dsg2 UTSW 18 20,716,061 (GRCm39) unclassified probably benign
R8118:Dsg2 UTSW 18 20,715,858 (GRCm39) missense probably benign 0.11
R8157:Dsg2 UTSW 18 20,713,606 (GRCm39) missense probably damaging 1.00
R8307:Dsg2 UTSW 18 20,708,121 (GRCm39) missense probably benign 0.19
R8308:Dsg2 UTSW 18 20,708,121 (GRCm39) missense probably benign 0.19
R8488:Dsg2 UTSW 18 20,734,431 (GRCm39) missense probably damaging 1.00
R8520:Dsg2 UTSW 18 20,712,508 (GRCm39) missense probably damaging 1.00
R8669:Dsg2 UTSW 18 20,723,132 (GRCm39) missense probably damaging 1.00
R8675:Dsg2 UTSW 18 20,734,975 (GRCm39) missense possibly damaging 0.75
R8750:Dsg2 UTSW 18 20,708,069 (GRCm39) missense possibly damaging 0.90
R8773:Dsg2 UTSW 18 20,716,056 (GRCm39) missense probably damaging 1.00
R8888:Dsg2 UTSW 18 20,723,126 (GRCm39) missense probably damaging 1.00
R8895:Dsg2 UTSW 18 20,723,126 (GRCm39) missense probably damaging 1.00
R8912:Dsg2 UTSW 18 20,715,878 (GRCm39) missense probably damaging 1.00
R8925:Dsg2 UTSW 18 20,725,535 (GRCm39) missense probably damaging 1.00
R8927:Dsg2 UTSW 18 20,725,535 (GRCm39) missense probably damaging 1.00
R9263:Dsg2 UTSW 18 20,727,223 (GRCm39) missense probably benign 0.33
R9328:Dsg2 UTSW 18 20,715,847 (GRCm39) missense possibly damaging 0.81
Z1176:Dsg2 UTSW 18 20,713,678 (GRCm39) missense probably damaging 1.00
Z1177:Dsg2 UTSW 18 20,735,306 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATAAGAGCGTATCCTCTCTGC -3'
(R):5'- AGCCTTAACCACGGATGAGG -3'

Sequencing Primer
(F):5'- AGTTCCTTTCATTTAAGTCAACCAC -3'
(R):5'- CGGATGAGGCCATTTATACACAGTC -3'
Posted On 2015-03-25