Mutagenetix > Incidental Mutation

Incidental Mutation 'R3774:Itgav'

273485

Institutional Source

Beutler Lab

Gene Symbol

Itgav

Ensembl Gene

ENSMUSG00000027087

Gene Name

integrin alpha V

Synonyms

alphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3774 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83724397-83806916 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83791964 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 630 (E630G)

Ref Sequence

ENSEMBL: ENSMUSP00000107369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]

AlphaFold

P43406

Predicted Effect

probably damaging
Transcript: ENSMUST00000028499
AA Change: E666G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: E666G

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	248	298	4.9e-13	SMART
Int_alpha	302	363	4.55e-8	SMART
Int_alpha	366	422	2.2e-15	SMART
Int_alpha	430	484	1.62e-4	SMART
SCOP:d1m1xa2	629	767	3e-49	SMART
SCOP:d1m1xa3	768	982	1e-89	SMART
low complexity region	995	1008	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111740
AA Change: E630G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: E630G

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	212	262	4.9e-13	SMART
Int_alpha	266	327	4.55e-8	SMART
Int_alpha	330	386	2.2e-15	SMART
Int_alpha	394	448	1.62e-4	SMART
SCOP:d1m1xa2	593	731	5e-49	SMART
SCOP:d1m1xa3	732	946	2e-89	SMART
low complexity region	959	972	N/A	INTRINSIC
Pfam:Integrin_alpha	977	991	1.3e-7	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadm	A	G	3: 153,933,097	V213A	probably benign	Het
Ccndbp1	A	G	2: 121,009,100	K26R	possibly damaging	Het
Chrna10	T	C	7: 102,114,328	T87A	probably benign	Het
Col27a1	T	A	4: 63,314,726	N360K	probably benign	Het
Crispld2	T	C	8: 120,029,266	S325P	probably damaging	Het
Dgkd	T	A	1: 87,936,300	I79N	probably damaging	Het
Dhdh	T	A	7: 45,481,938	D157V	probably benign	Het
Dnajc15	A	T	14: 77,856,937		probably null	Het
Fbxo44	G	T	4: 148,156,594	F179L	probably damaging	Het
Gm5565	T	A	5: 146,158,609	E192V	probably benign	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Iws1	T	C	18: 32,079,995	S159P	probably damaging	Het
Kif23	G	A	9: 61,924,992	S623L	probably benign	Het
Krt32	A	G	11: 100,088,121	C36R	probably benign	Het
Med12l	A	C	3: 59,247,942	Q1181P	probably damaging	Het
Megf10	G	A	18: 57,277,105	G653S	probably damaging	Het
Mon1a	A	G	9: 107,901,303	Y242C	probably damaging	Het
Msh6	G	T	17: 87,986,181	R788L	probably damaging	Het
Mttp	T	C	3: 138,114,263		probably null	Het
Mxi1	C	A	19: 53,371,729	A294E	probably benign	Het
Olfm5	T	A	7: 104,161,849	R27S	possibly damaging	Het
Olfr667	T	A	7: 104,916,906	Y130F	probably benign	Het
Palmd	T	C	3: 116,927,663	E81G	probably damaging	Het
Pecr	A	G	1: 72,259,371	F297L	probably benign	Het
Phf11b	A	G	14: 59,326,057	L137S	probably benign	Het
Phlpp1	GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	GAGCAGCAGCAGCAGCAGCAGCAGCAGC	1: 106,393,191		probably benign	Het
Plcb4	A	G	2: 135,958,145	K472E	probably benign	Het
Pomgnt1	G	A	4: 116,154,128	R230H	probably damaging	Het
Pomt1	A	G	2: 32,244,250	H261R	possibly damaging	Het
Ppm1d	T	C	11: 85,337,167	I303T	probably damaging	Het
Ptprc	T	G	1: 138,064,773	Q1205H	probably damaging	Het
Rad23b	C	T	4: 55,382,589	T264I	possibly damaging	Het
Rfc1	T	C	5: 65,264,406	Y1050C	probably damaging	Het
Sept8	T	C	11: 53,537,579	V352A	probably damaging	Het
Slc25a13	T	A	6: 6,109,288	Q358L	probably damaging	Het
Ssh1	T	C	5: 113,966,722	D12G	probably damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Tnik	T	C	3: 28,638,419	Y820H	probably damaging	Het
Trpm3	T	C	19: 22,978,602	F1143L	possibly damaging	Het
Trpm3	T	A	19: 22,987,975	S1611R	probably benign	Het
Ttyh3	A	G	5: 140,648,734	F32L	probably damaging	Het
Unkl	T	A	17: 25,188,407		probably null	Het
Vwf	T	A	6: 125,649,099		probably null	Het
Wdr11	T	A	7: 129,631,693		probably null	Het
Yeats2	A	G	16: 20,150,495	D12G	probably damaging	Het

Other mutations in Itgav

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Itgav	APN	2	83802995	missense	probably damaging	1.00
IGL01969:Itgav	APN	2	83803283	missense	probably damaging	1.00
IGL02371:Itgav	APN	2	83770053	missense	probably damaging	1.00
IGL02563:Itgav	APN	2	83771236	missense	probably benign
IGL02640:Itgav	APN	2	83791939	missense	probably benign	0.33
IGL02641:Itgav	APN	2	83768345	splice site	probably benign
IGL02927:Itgav	APN	2	83795540	missense	probably damaging	1.00
IGL03172:Itgav	APN	2	83765846	missense	possibly damaging	0.51
R0158:Itgav	UTSW	2	83792037	missense	probably benign	0.33
R0346:Itgav	UTSW	2	83792609	missense	probably damaging	1.00
R0508:Itgav	UTSW	2	83792658	splice site	probably benign
R0546:Itgav	UTSW	2	83803242	missense	probably benign	0.04
R0554:Itgav	UTSW	2	83794270	missense	possibly damaging	0.95
R1122:Itgav	UTSW	2	83791939	missense	probably benign	0.33
R1468:Itgav	UTSW	2	83765901	splice site	probably benign
R1566:Itgav	UTSW	2	83736630	missense	probably damaging	1.00
R1657:Itgav	UTSW	2	83801779	missense	probably benign	0.21
R1892:Itgav	UTSW	2	83771336	missense	probably damaging	1.00
R1912:Itgav	UTSW	2	83795486	missense	possibly damaging	0.85
R2176:Itgav	UTSW	2	83803255	missense	probably damaging	1.00
R2438:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R2449:Itgav	UTSW	2	83768750	critical splice donor site	probably null
R3110:Itgav	UTSW	2	83792571	nonsense	probably null
R3112:Itgav	UTSW	2	83792571	nonsense	probably null
R3176:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3177:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3276:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3277:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3766:Itgav	UTSW	2	83801885	critical splice donor site	probably null
R3880:Itgav	UTSW	2	83768301	missense	probably damaging	1.00
R4196:Itgav	UTSW	2	83768327	missense	probably benign	0.24
R4287:Itgav	UTSW	2	83724840	nonsense	probably null
R4620:Itgav	UTSW	2	83755902	missense	probably benign	0.07
R4790:Itgav	UTSW	2	83755810	missense	probably damaging	1.00
R4946:Itgav	UTSW	2	83788983	missense	probably benign	0.16
R6150:Itgav	UTSW	2	83776436	missense	probably benign
R6345:Itgav	UTSW	2	83802036	missense	probably damaging	1.00
R6482:Itgav	UTSW	2	83794270	missense	probably damaging	1.00
R6900:Itgav	UTSW	2	83803247	missense	probably damaging	1.00
R7247:Itgav	UTSW	2	83724835	missense	probably damaging	0.98
R7317:Itgav	UTSW	2	83794983	missense	probably benign	0.12
R7429:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7430:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7522:Itgav	UTSW	2	83802029	missense	probably benign	0.10
R7546:Itgav	UTSW	2	83776550	nonsense	probably null
R7578:Itgav	UTSW	2	83747875	missense	probably benign	0.16
R8311:Itgav	UTSW	2	83765777	missense	probably damaging	1.00
R8497:Itgav	UTSW	2	83785461	missense	probably damaging	1.00
R8744:Itgav	UTSW	2	83770083	missense	probably benign	0.25
R9752:Itgav	UTSW	2	83770107	critical splice donor site	probably null
V1662:Itgav	UTSW	2	83783854	missense	possibly damaging	0.91

Predicted Primers

Posted On

2015-03-25