Incidental Mutation 'R3774:Ccndbp1'
ID273486
Institutional Source Beutler Lab
Gene Symbol Ccndbp1
Ensembl Gene ENSMUSG00000023572
Gene Namecyclin D-type binding-protein 1
Synonymsstage specific embryonic cDNA-8, Maid, DIP1, SSEC-8, GCIP
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121008403-121016904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121009100 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 26 (K26R)
Ref Sequence ENSEMBL: ENSMUSP00000097088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060455] [ENSMUST00000067582] [ENSMUST00000099488] [ENSMUST00000099489] [ENSMUST00000110686] [ENSMUST00000139428] [ENSMUST00000171260]
Predicted Effect probably benign
Transcript: ENSMUST00000060455
AA Change: K73R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062496
Gene: ENSMUSG00000023572
AA Change: K73R

DomainStartEndE-ValueType
Pfam:GCIP 50 318 4.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067582
SMART Domains Protein: ENSMUSP00000064310
Gene: ENSMUSG00000054484

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Metallophos 56 261 7.3e-11 PFAM
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 479 501 N/A INTRINSIC
transmembrane domain 530 552 N/A INTRINSIC
transmembrane domain 573 595 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083949
Predicted Effect probably benign
Transcript: ENSMUST00000099488
AA Change: K73R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097087
Gene: ENSMUSG00000023572
AA Change: K73R

DomainStartEndE-ValueType
Pfam:GCIP 50 311 4.8e-90 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099489
AA Change: K26R

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097088
Gene: ENSMUSG00000023572
AA Change: K26R

DomainStartEndE-ValueType
Pfam:GCIP 3 271 3.7e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110686
SMART Domains Protein: ENSMUSP00000106314
Gene: ENSMUSG00000054484

DomainStartEndE-ValueType
transmembrane domain 300 322 N/A INTRINSIC
transmembrane domain 349 371 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135599
Predicted Effect probably benign
Transcript: ENSMUST00000139428
SMART Domains Protein: ENSMUSP00000118808
Gene: ENSMUSG00000054484

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
SCOP:d1utea_ 59 274 9e-9 SMART
low complexity region 308 327 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151532
Predicted Effect probably benign
Transcript: ENSMUST00000171260
AA Change: K73R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125961
Gene: ENSMUSG00000023572
AA Change: K73R

DomainStartEndE-ValueType
Pfam:GCIP 52 309 4.7e-74 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the interaction of its gene product with Grap2, a leukocyte-specific adaptor protein important for immune cell signaling. The protein encoded by this gene was shown to interact with cyclin D. Transfection of this gene in cells was reported to reduce the phosphorylation of Rb gene product by cyclin D-dependent protein kinase, and inhibit E2F1-mediated transcription activity. This protein was also found to interact with helix-loop-helix protein E12 and is thought to be a negative regulator of liver-specific gene expression. Several alternatively spliced variants have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit a delay in G1/S-phase progression of hepatocytes after partial hepatectomy and develop hepatocellular carcinomas at an advanced age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Ccndbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02305:Ccndbp1 APN 2 121011452 missense probably damaging 1.00
R0141:Ccndbp1 UTSW 2 121012422 missense probably damaging 1.00
R4490:Ccndbp1 UTSW 2 121012395 missense probably damaging 0.97
R4695:Ccndbp1 UTSW 2 121014727 unclassified probably benign
R4783:Ccndbp1 UTSW 2 121008522 missense probably benign 0.00
R4784:Ccndbp1 UTSW 2 121008522 missense probably benign 0.00
R4785:Ccndbp1 UTSW 2 121008522 missense probably benign 0.00
R4878:Ccndbp1 UTSW 2 121014691 nonsense probably null
R5637:Ccndbp1 UTSW 2 121011684 missense probably benign 0.08
R5687:Ccndbp1 UTSW 2 121014702 unclassified probably benign
R6363:Ccndbp1 UTSW 2 121012973 missense probably damaging 1.00
R6913:Ccndbp1 UTSW 2 121009866 missense probably benign 0.01
R7192:Ccndbp1 UTSW 2 121012943 missense probably damaging 1.00
R7601:Ccndbp1 UTSW 2 121016146 missense probably damaging 0.99
R8071:Ccndbp1 UTSW 2 121014565 missense unknown
R8283:Ccndbp1 UTSW 2 121008584 unclassified probably benign
Predicted Primers
Posted On2015-03-25