Incidental Mutation 'R3774:Palmd'
ID273490
Institutional Source Beutler Lab
Gene Symbol Palmd
Ensembl Gene ENSMUSG00000033377
Gene Namepalmdelphin
Synonyms4631423C22Rik, PALML
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location116918258-116968987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116927663 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 81 (E81G)
Ref Sequence ENSEMBL: ENSMUSP00000122725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040097] [ENSMUST00000119557] [ENSMUST00000143611]
Predicted Effect probably damaging
Transcript: ENSMUST00000040097
AA Change: E93G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044693
Gene: ENSMUSG00000033377
AA Change: E93G

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:Paralemmin 65 512 3.6e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119557
AA Change: E93G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113107
Gene: ENSMUSG00000033377
AA Change: E93G

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:Paralemmin 64 278 6.6e-14 PFAM
Pfam:Paralemmin 323 515 1.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143611
AA Change: E81G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122725
Gene: ENSMUSG00000033377
AA Change: E81G

DomainStartEndE-ValueType
coiled coil region 4 94 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Palmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Palmd APN 3 116927391 splice site probably benign
IGL01112:Palmd APN 3 116924273 missense probably damaging 1.00
IGL01484:Palmd APN 3 116953145 splice site probably benign
IGL01527:Palmd APN 3 116927188 nonsense probably null
IGL01561:Palmd APN 3 116924093 missense probably damaging 0.99
IGL01975:Palmd APN 3 116923634 missense probably benign 0.24
R0107:Palmd UTSW 3 116924076 missense probably damaging 1.00
R1099:Palmd UTSW 3 116923225 missense possibly damaging 0.71
R1552:Palmd UTSW 3 116948040 splice site probably benign
R1613:Palmd UTSW 3 116923504 missense probably damaging 1.00
R1710:Palmd UTSW 3 116923657 missense probably damaging 1.00
R2090:Palmd UTSW 3 116927434 missense probably damaging 1.00
R2869:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2869:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2870:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2870:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2871:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2871:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2872:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2872:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2873:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R3981:Palmd UTSW 3 116923823 missense probably benign 0.01
R3982:Palmd UTSW 3 116923823 missense probably benign 0.01
R3983:Palmd UTSW 3 116923823 missense probably benign 0.01
R4955:Palmd UTSW 3 116924224 missense probably damaging 1.00
R5103:Palmd UTSW 3 116927421 missense probably damaging 1.00
R5261:Palmd UTSW 3 116923360 missense probably benign 0.04
R5265:Palmd UTSW 3 116923849 missense possibly damaging 0.67
R5292:Palmd UTSW 3 116923744 missense probably benign 0.00
R5499:Palmd UTSW 3 116923832 missense probably benign 0.01
R5597:Palmd UTSW 3 116923576 missense probably damaging 1.00
R5666:Palmd UTSW 3 116924101 missense possibly damaging 0.55
R5817:Palmd UTSW 3 116918623 missense probably benign 0.01
R6843:Palmd UTSW 3 116924215 missense probably damaging 1.00
R6854:Palmd UTSW 3 116923463 missense probably benign 0.06
R7052:Palmd UTSW 3 116923363 missense probably benign 0.30
R7450:Palmd UTSW 3 116927643 missense probably damaging 1.00
Z1177:Palmd UTSW 3 116923502 missense probably damaging 1.00
Predicted Primers
Posted On2015-03-25