Incidental Mutation 'R3774:Mttp'
ID273491
Institutional Source Beutler Lab
Gene Symbol Mttp
Ensembl Gene ENSMUSG00000028158
Gene Namemicrosomal triglyceride transfer protein
Synonyms1810043K16Rik, MTP
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location138089854-138144968 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 138114263 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029805] [ENSMUST00000098580]
Predicted Effect probably null
Transcript: ENSMUST00000029805
SMART Domains Protein: ENSMUSP00000029805
Gene: ENSMUSG00000028158

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LPD_N 28 579 8.87e-165 SMART
Blast:LPD_N 582 695 4e-58 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000098580
SMART Domains Protein: ENSMUSP00000096179
Gene: ENSMUSG00000028158

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LPD_N 43 594 8.87e-165 SMART
Blast:LPD_N 597 710 6e-58 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196625
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a reporter allele die at midgestation displaying delayed growth, neurodevelopmental anomalies, impaired erythropoiesis, deficient yolk sac lipoprotein production, hemorrhage and necrosis. Heterozygous mutant mice display altered plasma lipid and lipoprotein profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Mttp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Mttp APN 3 138109015 missense possibly damaging 0.84
IGL00983:Mttp APN 3 138115129 splice site probably benign
IGL01128:Mttp APN 3 138133997 splice site probably null
IGL01607:Mttp APN 3 138104698 missense probably damaging 0.99
IGL01760:Mttp APN 3 138111736 missense probably benign 0.00
IGL01947:Mttp APN 3 138107129 missense probably damaging 1.00
IGL02184:Mttp APN 3 138116000 critical splice donor site probably null
IGL02932:Mttp APN 3 138111744 missense probably benign 0.07
IGL02957:Mttp APN 3 138109081 missense possibly damaging 0.95
IGL03082:Mttp APN 3 138123795 missense probably benign 0.01
IGL03302:Mttp APN 3 138104707 missense possibly damaging 0.90
IGL03381:Mttp APN 3 138104943 missense probably damaging 1.00
P0040:Mttp UTSW 3 138112566 missense possibly damaging 0.82
R0543:Mttp UTSW 3 138111696 missense possibly damaging 0.75
R0738:Mttp UTSW 3 138103313 missense probably damaging 1.00
R0967:Mttp UTSW 3 138092723 missense probably benign 0.00
R1281:Mttp UTSW 3 138107219 missense possibly damaging 0.95
R1565:Mttp UTSW 3 138116405 critical splice donor site probably null
R1660:Mttp UTSW 3 138103193 missense probably damaging 1.00
R1828:Mttp UTSW 3 138107280 missense probably damaging 1.00
R1886:Mttp UTSW 3 138092615 missense probably damaging 1.00
R1912:Mttp UTSW 3 138116027 missense probably benign 0.01
R1938:Mttp UTSW 3 138125121 missense probably benign 0.21
R2020:Mttp UTSW 3 138118402 missense probably damaging 0.98
R2109:Mttp UTSW 3 138095002 missense probably benign 0.27
R2336:Mttp UTSW 3 138116095 missense possibly damaging 0.81
R2392:Mttp UTSW 3 138095021 missense probably damaging 0.98
R3021:Mttp UTSW 3 138111703 missense probably benign
R3776:Mttp UTSW 3 138114263 intron probably null
R4687:Mttp UTSW 3 138092735 missense possibly damaging 0.66
R4708:Mttp UTSW 3 138134098 unclassified probably benign
R4756:Mttp UTSW 3 138116071 missense possibly damaging 0.77
R4832:Mttp UTSW 3 138116050 missense probably benign
R5377:Mttp UTSW 3 138105029 missense probably benign 0.03
R5670:Mttp UTSW 3 138125113 missense probably damaging 0.99
R6613:Mttp UTSW 3 138109078 missense probably damaging 1.00
R6725:Mttp UTSW 3 138107238 missense probably damaging 1.00
R6799:Mttp UTSW 3 138095080 missense probably benign 0.04
R6920:Mttp UTSW 3 138115282 missense possibly damaging 0.49
R7074:Mttp UTSW 3 138107273 missense possibly damaging 0.53
R7131:Mttp UTSW 3 138116132 missense probably benign 0.13
R7275:Mttp UTSW 3 138123785 missense probably benign 0.19
R7291:Mttp UTSW 3 138091203 missense probably damaging 1.00
R7310:Mttp UTSW 3 138095022 missense probably damaging 1.00
R7769:Mttp UTSW 3 138103112 missense probably damaging 1.00
R7909:Mttp UTSW 3 138118417 nonsense probably null
R7990:Mttp UTSW 3 138118417 nonsense probably null
R8037:Mttp UTSW 3 138091122 missense probably damaging 1.00
R8220:Mttp UTSW 3 138123848 missense probably benign 0.00
Z1176:Mttp UTSW 3 138104779 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGCCCTGAAAAGCAATGTG -3'
(R):5'- TCCAAACCTCAGATGGCTAATG -3'

Sequencing Primer
(F):5'- TTCAGAATCTGGAGGATCTCTTC -3'
(R):5'- CTCAGATGGCTAATGGTCCAAGGTC -3'
Posted On2015-03-25