Incidental Mutation 'R3774:Acadm'
ID273492
Institutional Source Beutler Lab
Gene Symbol Acadm
Ensembl Gene ENSMUSG00000062908
Gene Nameacyl-Coenzyme A dehydrogenase, medium chain
SynonymsMCAD
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location153922357-153944632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153933097 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 213 (V213A)
Ref Sequence ENSEMBL: ENSMUSP00000072483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072697] [ENSMUST00000150070] [ENSMUST00000156310]
Predicted Effect probably benign
Transcript: ENSMUST00000072697
AA Change: V213A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072483
Gene: ENSMUSG00000062908
AA Change: V213A

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 42 152 2e-27 PFAM
Pfam:Acyl-CoA_dh_M 157 255 2.3e-26 PFAM
Pfam:Acyl-CoA_dh_1 267 416 1.7e-48 PFAM
Pfam:Acyl-CoA_dh_2 283 405 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150070
SMART Domains Protein: ENSMUSP00000121714
Gene: ENSMUSG00000062908

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 36 121 5.4e-21 PFAM
Pfam:Acyl-CoA_dh_M 125 144 5.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156310
SMART Domains Protein: ENSMUSP00000122989
Gene: ENSMUSG00000062908

DomainStartEndE-ValueType
PDB:2A1T|D 1 77 2e-30 PDB
SCOP:d3mdda2 36 88 2e-9 SMART
low complexity region 101 111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200250
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homotetrameric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum length between C6- and C12-acylCoA. In mice, deficiency of this gene can cause neonatal mortality as well as fasting and cold intolerance. This gene has multiple, intronless pseudogenes. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display a high degree of postnatal lethality, develop an organic aciduria, fatty liver and an unexpected diffuse cardiomyopathy with multifocal myocyte degeneration and necrosis, and show severe cold intolerance with prior fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Acadm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02452:Acadm APN 3 153941970 missense probably damaging 1.00
IGL02598:Acadm APN 3 153938544 splice site probably benign
IGL02642:Acadm APN 3 153939083 missense probably damaging 1.00
R0092:Acadm UTSW 3 153941875 splice site probably benign
R0270:Acadm UTSW 3 153936324 missense possibly damaging 0.89
R1543:Acadm UTSW 3 153929572 missense probably damaging 1.00
R1868:Acadm UTSW 3 153930252 missense probably benign 0.03
R1955:Acadm UTSW 3 153929551 missense probably damaging 0.97
R2281:Acadm UTSW 3 153933043 missense possibly damaging 0.75
R4768:Acadm UTSW 3 153922942 missense probably benign 0.00
R4994:Acadm UTSW 3 153929584 missense probably damaging 1.00
R5194:Acadm UTSW 3 153933118 missense possibly damaging 0.63
R5523:Acadm UTSW 3 153938636 missense probably benign 0.13
R5927:Acadm UTSW 3 153939108 missense probably damaging 1.00
R6109:Acadm UTSW 3 153941943 missense probably damaging 1.00
R6223:Acadm UTSW 3 153938549 splice site probably null
R6896:Acadm UTSW 3 153936320 missense probably damaging 0.99
R7108:Acadm UTSW 3 153925800 nonsense probably null
R7182:Acadm UTSW 3 153941881 critical splice donor site probably null
R7334:Acadm UTSW 3 153939061 nonsense probably null
R7440:Acadm UTSW 3 153922989 missense probably damaging 1.00
R7882:Acadm UTSW 3 153938613 nonsense probably null
R8170:Acadm UTSW 3 153944398 missense possibly damaging 0.93
R8405:Acadm UTSW 3 153929528 splice site probably benign
Predicted Primers
Posted On2015-03-25