Incidental Mutation 'R3774:Rad23b'
ID273493
Institutional Source Beutler Lab
Gene Symbol Rad23b
Ensembl Gene ENSMUSG00000028426
Gene NameRAD23 homolog B, nucleotide excision repair protein
Synonyms0610007D13Rik, mHR23B
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location55350043-55392237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55382589 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 264 (T264I)
Ref Sequence ENSEMBL: ENSMUSP00000030134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030134]
PDB Structure
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030134
AA Change: T264I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030134
Gene: ENSMUSG00000028426
AA Change: T264I

DomainStartEndE-ValueType
UBQ 1 75 8.79e-24 SMART
low complexity region 79 143 N/A INTRINSIC
UBA 190 227 3.1e-11 SMART
low complexity region 257 270 N/A INTRINSIC
STI1 274 317 3.37e-10 SMART
UBA 373 410 6.35e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156263
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene usually die around the time of birth. Those that survive show growth retardation, eye, reproductive, behavioral, and digestive system abnormalities. They usually die within 1 year of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Rad23b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Rad23b APN 4 55366774 splice site probably benign
IGL01326:Rad23b APN 4 55383601 missense possibly damaging 0.95
IGL02398:Rad23b APN 4 55350360 utr 5 prime probably benign
IGL02506:Rad23b APN 4 55382511 missense probably benign 0.01
IGL02538:Rad23b APN 4 55370457 missense possibly damaging 0.67
Saguaro UTSW 4 55370474 critical splice donor site probably null
R0278:Rad23b UTSW 4 55383575 splice site probably null
R1846:Rad23b UTSW 4 55383637 nonsense probably null
R2198:Rad23b UTSW 4 55385497 missense possibly damaging 0.68
R2425:Rad23b UTSW 4 55385438 missense probably damaging 0.99
R3781:Rad23b UTSW 4 55382586 missense probably damaging 1.00
R4197:Rad23b UTSW 4 55385455 missense probably damaging 0.98
R5911:Rad23b UTSW 4 55370474 critical splice donor site probably null
R6056:Rad23b UTSW 4 55382540 missense probably benign 0.01
R6067:Rad23b UTSW 4 55370400 missense probably damaging 0.97
R6078:Rad23b UTSW 4 55370400 missense probably damaging 0.97
R6079:Rad23b UTSW 4 55370400 missense probably damaging 0.97
R7426:Rad23b UTSW 4 55370469 missense probably benign 0.00
U15987:Rad23b UTSW 4 55370400 missense probably damaging 0.97
Predicted Primers
Posted On2015-03-25