Incidental Mutation 'R3774:Fbxo44'
ID273496
Institutional Source Beutler Lab
Gene Symbol Fbxo44
Ensembl Gene ENSMUSG00000029001
Gene NameF-box protein 44
SynonymsFBG3, Fbx6a, FBX30, Fbxo6a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location148152800-148160482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 148156594 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 179 (F179L)
Ref Sequence ENSEMBL: ENSMUSP00000134624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030858] [ENSMUST00000047951] [ENSMUST00000056965] [ENSMUST00000057907] [ENSMUST00000105705] [ENSMUST00000105706] [ENSMUST00000122913] [ENSMUST00000129253] [ENSMUST00000132083] [ENSMUST00000134261] [ENSMUST00000151127] [ENSMUST00000151246] [ENSMUST00000152098] [ENSMUST00000167160] [ENSMUST00000168503] [ENSMUST00000172472] [ENSMUST00000173352]
Predicted Effect probably benign
Transcript: ENSMUST00000030858
SMART Domains Protein: ENSMUSP00000030858
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047951
SMART Domains Protein: ENSMUSP00000037377
Gene: ENSMUSG00000041556

DomainStartEndE-ValueType
Pfam:F-box 50 97 3.8e-9 PFAM
Pfam:F-box-like 51 97 9.3e-8 PFAM
FBA 114 297 3.81e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056965
SMART Domains Protein: ENSMUSP00000062348
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000057907
AA Change: F126L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054022
Gene: ENSMUSG00000029001
AA Change: F126L

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105705
SMART Domains Protein: ENSMUSP00000101330
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 196 2.79e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105706
SMART Domains Protein: ENSMUSP00000101331
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122913
SMART Domains Protein: ENSMUSP00000120874
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
Pfam:FBA 68 115 3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129253
AA Change: F126L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117013
Gene: ENSMUSG00000029001
AA Change: F126L

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 213 1.15e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132083
SMART Domains Protein: ENSMUSP00000120431
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134261
SMART Domains Protein: ENSMUSP00000123132
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 228 1.89e-85 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151127
AA Change: F126L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134064
Gene: ENSMUSG00000029001
AA Change: F126L

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 235 4.09e-63 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151246
AA Change: F126L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114571
Gene: ENSMUSG00000029001
AA Change: F126L

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 231 1.43e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152098
SMART Domains Protein: ENSMUSP00000121379
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect unknown
Transcript: ENSMUST00000153703
AA Change: F58L
SMART Domains Protein: ENSMUSP00000115937
Gene: ENSMUSG00000029001
AA Change: F58L

DomainStartEndE-ValueType
FBA 1 143 3.11e-54 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167160
AA Change: F126L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126551
Gene: ENSMUSG00000029001
AA Change: F126L

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168503
SMART Domains Protein: ENSMUSP00000130188
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172472
SMART Domains Protein: ENSMUSP00000133966
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
Pfam:FBA 68 126 3.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173352
AA Change: F179L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134624
Gene: ENSMUSG00000029001
AA Change: F179L

DomainStartEndE-ValueType
FBOX 62 103 1.37e-2 SMART
FBA 121 254 3.86e-50 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It is also a member of the NFB42 (neural F Box 42 kDa) family, similar to F-box only protein 2 and F-box only protein 6. Several alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Fbxo44
AlleleSourceChrCoordTypePredicted EffectPPH Score
trompo UTSW 4 148156004 missense probably benign
R0040:Fbxo44 UTSW 4 148158695 missense probably damaging 1.00
R0737:Fbxo44 UTSW 4 148158809 utr 5 prime probably benign
R0850:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R0899:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R1169:Fbxo44 UTSW 4 148155976 missense probably benign 0.01
R1423:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R1889:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R1895:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R3712:Fbxo44 UTSW 4 148156004 missense probably benign
R3834:Fbxo44 UTSW 4 148156250 missense probably damaging 1.00
R4411:Fbxo44 UTSW 4 148153608 missense probably damaging 1.00
R4810:Fbxo44 UTSW 4 148156446 missense probably damaging 1.00
R5086:Fbxo44 UTSW 4 148156212 missense probably benign 0.00
R5108:Fbxo44 UTSW 4 148158563 missense probably damaging 1.00
R5344:Fbxo44 UTSW 4 148153573 missense probably damaging 0.98
R5423:Fbxo44 UTSW 4 148154229 missense probably benign 0.00
R5930:Fbxo44 UTSW 4 148156595 missense probably damaging 1.00
R6017:Fbxo44 UTSW 4 148158553 missense probably benign 0.17
R6132:Fbxo44 UTSW 4 148156108 missense probably benign 0.10
R6498:Fbxo44 UTSW 4 148154425
R7085:Fbxo44 UTSW 4 148158743 missense probably damaging 0.98
R7142:Fbxo44 UTSW 4 148158812 missense unknown
R7374:Fbxo44 UTSW 4 148156637 missense probably benign 0.21
R7679:Fbxo44 UTSW 4 148153632 missense probably benign 0.43
R8306:Fbxo44 UTSW 4 148158632 missense probably benign 0.42
X0017:Fbxo44 UTSW 4 148156223 missense probably damaging 1.00
Predicted Primers
Posted On2015-03-25