Incidental Mutation 'R3774:Ssh1'
ID273498
Institutional Source Beutler Lab
Gene Symbol Ssh1
Ensembl Gene ENSMUSG00000042121
Gene Nameslingshot protein phosphatase 1
SynonymsmSSH-1L, LOC384311
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3774 (G1)
Quality Score140
Status Not validated
Chromosome5
Chromosomal Location113937094-113993894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113966722 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 12 (D12G)
Ref Sequence ENSEMBL: ENSMUSP00000125388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077689] [ENSMUST00000112298] [ENSMUST00000159510] [ENSMUST00000159592] [ENSMUST00000162396]
Predicted Effect probably damaging
Transcript: ENSMUST00000077689
AA Change: D46G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076873
Gene: ENSMUSG00000042121
AA Change: D46G

DomainStartEndE-ValueType
Pfam:DEK_C 208 261 1.1e-19 PFAM
DSPc 265 403 7.82e-47 SMART
low complexity region 490 503 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 686 704 N/A INTRINSIC
low complexity region 732 748 N/A INTRINSIC
low complexity region 874 892 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112298
AA Change: D89G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107917
Gene: ENSMUSG00000042121
AA Change: D89G

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 229 282 9.5e-20 PFAM
DSPc 286 424 7.82e-47 SMART
low complexity region 511 524 N/A INTRINSIC
low complexity region 675 690 N/A INTRINSIC
low complexity region 707 725 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
low complexity region 895 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159510
Predicted Effect probably damaging
Transcript: ENSMUST00000159592
AA Change: D89G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124312
Gene: ENSMUSG00000042121
AA Change: D89G

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 252 303 2.3e-17 PFAM
DSPc 308 446 7.82e-47 SMART
low complexity region 533 546 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
low complexity region 729 747 N/A INTRINSIC
low complexity region 775 791 N/A INTRINSIC
low complexity region 917 935 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162322
Predicted Effect probably damaging
Transcript: ENSMUST00000162396
AA Change: D12G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the slingshot homolog (SSH) family of phosphatases, which regulate actin filament dynamics. The SSH proteins dephosphorylate and activate the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Cofilin is inactivated by kinases such as LIM domain kinase-1 (LIMK1), which may also be dephosphorylated and inactivated by SSH proteins. The SSH family thus appears to play a role in actin dynamics by reactivating cofilin proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Ssh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Ssh1 APN 5 113942576 missense probably damaging 1.00
IGL01432:Ssh1 APN 5 113958822 missense probably benign 0.31
IGL01933:Ssh1 APN 5 113950380 splice site probably benign
IGL01951:Ssh1 APN 5 113966247 missense possibly damaging 0.64
IGL02117:Ssh1 APN 5 113946480 nonsense probably null
IGL02391:Ssh1 APN 5 113942517 missense probably damaging 1.00
R0110:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0469:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0510:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0682:Ssh1 UTSW 5 113960657 missense probably damaging 1.00
R0863:Ssh1 UTSW 5 113966731 missense probably damaging 1.00
R0939:Ssh1 UTSW 5 113970436 missense probably damaging 1.00
R1539:Ssh1 UTSW 5 113952003 missense probably damaging 1.00
R1716:Ssh1 UTSW 5 113952020 missense possibly damaging 0.80
R1754:Ssh1 UTSW 5 113955845 missense probably damaging 0.99
R1867:Ssh1 UTSW 5 113943451 missense probably damaging 1.00
R2261:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2262:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2497:Ssh1 UTSW 5 113958858 missense probably damaging 1.00
R3922:Ssh1 UTSW 5 113942708 missense possibly damaging 0.52
R5120:Ssh1 UTSW 5 113957398 missense possibly damaging 0.89
R5283:Ssh1 UTSW 5 113950545 missense probably damaging 1.00
R5810:Ssh1 UTSW 5 113946566 missense probably benign 0.05
R5877:Ssh1 UTSW 5 113943120 missense probably benign 0.29
R6140:Ssh1 UTSW 5 113942631 missense probably benign 0.16
R6360:Ssh1 UTSW 5 113961347 splice site probably null
R6612:Ssh1 UTSW 5 113958730 missense probably benign 0.43
R6819:Ssh1 UTSW 5 113946790 missense probably benign
R6855:Ssh1 UTSW 5 113942575 missense probably damaging 1.00
R7389:Ssh1 UTSW 5 113958831 missense probably benign 0.28
R7470:Ssh1 UTSW 5 113942427 missense possibly damaging 0.63
R7568:Ssh1 UTSW 5 113957380 splice site probably null
R7647:Ssh1 UTSW 5 113942958 missense probably benign 0.00
R7649:Ssh1 UTSW 5 113950551 missense probably benign 0.12
R7754:Ssh1 UTSW 5 113966234 missense probably benign 0.31
R7887:Ssh1 UTSW 5 113961349 critical splice donor site probably null
R8167:Ssh1 UTSW 5 113951990 missense possibly damaging 0.49
R8289:Ssh1 UTSW 5 113942384 missense probably benign 0.01
Z1177:Ssh1 UTSW 5 113966294 missense possibly damaging 0.92
Predicted Primers
Posted On2015-03-25