Incidental Mutation 'R3774:Ttyh3'
ID273500
Institutional Source Beutler Lab
Gene Symbol Ttyh3
Ensembl Gene ENSMUSG00000036565
Gene Nametweety family member 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3774 (G1)
Quality Score118
Status Not validated
Chromosome5
Chromosomal Location140620578-140649031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140648734 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 32 (F32L)
Ref Sequence ENSEMBL: ENSMUSP00000142655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042661] [ENSMUST00000197452]
Predicted Effect probably damaging
Transcript: ENSMUST00000042661
AA Change: F32L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037447
Gene: ENSMUSG00000036565
AA Change: F32L

DomainStartEndE-ValueType
Pfam:Tweety 25 430 9.4e-183 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197452
AA Change: F32L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142655
Gene: ENSMUSG00000036565
AA Change: F32L

DomainStartEndE-ValueType
Pfam:Tweety 25 430 1.8e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200302
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tweety family of proteins. Members of this family function as chloride anion channels. The encoded protein functions as a calcium(2+)-activated large conductance chloride(-) channel. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Ttyh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Ttyh3 APN 5 140629412 missense probably damaging 0.99
IGL01324:Ttyh3 APN 5 140631513 missense probably benign 0.00
IGL01982:Ttyh3 APN 5 140636074 splice site probably benign
IGL02002:Ttyh3 APN 5 140629483 missense probably damaging 1.00
IGL02218:Ttyh3 APN 5 140626491 missense probably damaging 1.00
IGL02385:Ttyh3 APN 5 140633305 missense probably benign 0.03
IGL02510:Ttyh3 APN 5 140629464 missense probably damaging 1.00
R0843:Ttyh3 UTSW 5 140626446 splice site probably null
R3037:Ttyh3 UTSW 5 140648842 start gained probably benign
R4795:Ttyh3 UTSW 5 140634786 missense probably damaging 1.00
R4796:Ttyh3 UTSW 5 140634786 missense probably damaging 1.00
R4868:Ttyh3 UTSW 5 140629466 missense probably damaging 1.00
R5671:Ttyh3 UTSW 5 140631552 missense probably benign 0.02
R6107:Ttyh3 UTSW 5 140633562 critical splice donor site probably null
R6363:Ttyh3 UTSW 5 140635224 missense probably damaging 1.00
R7104:Ttyh3 UTSW 5 140629785 missense probably benign 0.00
R7454:Ttyh3 UTSW 5 140629425 missense possibly damaging 0.95
R7798:Ttyh3 UTSW 5 140634783 missense probably damaging 1.00
R7810:Ttyh3 UTSW 5 140625141 missense
Predicted Primers
Posted On2015-03-25