Incidental Mutation 'R3774:Slc25a13'
ID273501
Institutional Source Beutler Lab
Gene Symbol Slc25a13
Ensembl Gene ENSMUSG00000015112
Gene Namesolute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13
Synonymscitrin, Ctrn
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location6041218-6217173 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6109288 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 358 (Q358L)
Ref Sequence ENSEMBL: ENSMUSP00000139571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015256] [ENSMUST00000188414]
Predicted Effect probably damaging
Transcript: ENSMUST00000015256
AA Change: Q358L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015256
Gene: ENSMUSG00000015112
AA Change: Q358L

DomainStartEndE-ValueType
EFh 57 85 5.75e1 SMART
EFh 91 119 6.14e-1 SMART
EFh 162 190 7.87e1 SMART
Pfam:Mito_carr 327 424 5.2e-27 PFAM
Pfam:Mito_carr 425 516 1.2e-17 PFAM
Pfam:Mito_carr 517 612 1.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177698
AA Change: Q304L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143688
Gene: ENSMUSG00000015112
AA Change: Q304L

DomainStartEndE-ValueType
EFh 52 80 2.8e-1 SMART
EFh 86 114 3.1e-3 SMART
Pfam:Mito_carr 273 339 3.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188414
AA Change: Q358L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139571
Gene: ENSMUSG00000015112
AA Change: Q358L

DomainStartEndE-ValueType
EFh 57 85 5.75e1 SMART
EFh 91 119 6.14e-1 SMART
EFh 162 190 7.87e1 SMART
Pfam:Mito_carr 327 424 2.6e-26 PFAM
Pfam:Mito_carr 425 516 4.4e-19 PFAM
Pfam:Mito_carr 517 612 1.4e-29 PFAM
Meta Mutation Damage Score 0.9433 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene appear normal, healthy and fertile, although they have a number of metabolic defects, but the spontaneous hyperspin deletion spanning from intron 3 to exon 17 also eliminates a modifier of Dlx5 causing a recessive vestibular and mortality phenotype [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Slc25a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Slc25a13 APN 6 6042739 critical splice donor site probably null
IGL02237:Slc25a13 APN 6 6042646 missense probably damaging 1.00
IGL02285:Slc25a13 APN 6 6042643 missense possibly damaging 0.95
IGL02287:Slc25a13 APN 6 6216992 splice site probably benign
IGL02593:Slc25a13 APN 6 6042265 missense probably benign 0.00
R0028:Slc25a13 UTSW 6 6181047 missense probably benign 0.10
R0045:Slc25a13 UTSW 6 6109277 missense probably benign 0.05
R0384:Slc25a13 UTSW 6 6042600 nonsense probably null
R0711:Slc25a13 UTSW 6 6117128 missense probably damaging 0.99
R1299:Slc25a13 UTSW 6 6113937 critical splice donor site probably null
R1625:Slc25a13 UTSW 6 6096675 missense probably damaging 1.00
R1701:Slc25a13 UTSW 6 6152525 critical splice acceptor site probably null
R1792:Slc25a13 UTSW 6 6115104 missense possibly damaging 0.79
R1932:Slc25a13 UTSW 6 6042264 missense probably benign 0.33
R1933:Slc25a13 UTSW 6 6109262 missense probably damaging 1.00
R1952:Slc25a13 UTSW 6 6152482 missense probably damaging 1.00
R1969:Slc25a13 UTSW 6 6096668 critical splice donor site probably null
R2027:Slc25a13 UTSW 6 6073487 missense probably damaging 1.00
R2074:Slc25a13 UTSW 6 6114017 missense probably benign 0.21
R2432:Slc25a13 UTSW 6 6114017 missense probably benign 0.21
R2508:Slc25a13 UTSW 6 6117190 missense probably benign 0.06
R3775:Slc25a13 UTSW 6 6109288 missense probably damaging 1.00
R4804:Slc25a13 UTSW 6 6109213 missense probably damaging 1.00
R4816:Slc25a13 UTSW 6 6114274 missense possibly damaging 0.71
R4978:Slc25a13 UTSW 6 6042300 missense probably damaging 0.97
R6529:Slc25a13 UTSW 6 6073451 missense probably benign 0.39
R6615:Slc25a13 UTSW 6 6073454 missense probably damaging 1.00
R6709:Slc25a13 UTSW 6 6073440 missense possibly damaging 0.88
R7346:Slc25a13 UTSW 6 6181100 missense possibly damaging 0.67
R7571:Slc25a13 UTSW 6 6052785 missense probably damaging 1.00
R7807:Slc25a13 UTSW 6 6117164 missense probably damaging 0.99
R7852:Slc25a13 UTSW 6 6152461 missense probably damaging 0.96
Predicted Primers
Posted On2015-03-25