Incidental Mutation 'R3774:Olfm5'
ID273505
Institutional Source Beutler Lab
Gene Symbol Olfm5
Ensembl Gene ENSMUSG00000044265
Gene Nameolfactomedin 5
SynonymsE030002O03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3774 (G1)
Quality Score181
Status Not validated
Chromosome7
Chromosomal Location104153013-104164831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104161849 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 27 (R27S)
Ref Sequence ENSEMBL: ENSMUSP00000052174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051137] [ENSMUST00000154555]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051137
AA Change: R27S

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052174
Gene: ENSMUSG00000044265
AA Change: R27S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 85 N/A INTRINSIC
coiled coil region 157 198 N/A INTRINSIC
OLF 211 468 3.13e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154555
AA Change: R27S

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117893
Gene: ENSMUSG00000044265
AA Change: R27S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 123 N/A INTRINSIC
OLF 136 304 3.65e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Olfm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Olfm5 APN 7 104160744 missense possibly damaging 0.77
IGL02097:Olfm5 APN 7 104154231 missense probably benign 0.20
IGL02322:Olfm5 APN 7 104154401 missense probably damaging 1.00
IGL02324:Olfm5 APN 7 104154095 unclassified probably null
IGL02702:Olfm5 APN 7 104154357 missense probably damaging 1.00
R0128:Olfm5 UTSW 7 104160926 missense probably benign
R0400:Olfm5 UTSW 7 104154179 missense probably damaging 1.00
R0600:Olfm5 UTSW 7 104153869 nonsense probably null
R0610:Olfm5 UTSW 7 104154445 nonsense probably null
R0699:Olfm5 UTSW 7 104154119 missense probably damaging 1.00
R1960:Olfm5 UTSW 7 104160412 missense possibly damaging 0.85
R1978:Olfm5 UTSW 7 104164741 missense unknown
R2391:Olfm5 UTSW 7 104160834 missense probably benign 0.00
R4632:Olfm5 UTSW 7 104160893 missense probably benign 0.00
R4770:Olfm5 UTSW 7 104160478 missense probably benign 0.04
R4838:Olfm5 UTSW 7 104154365 missense probably damaging 1.00
R5274:Olfm5 UTSW 7 104159983 missense probably damaging 1.00
R5455:Olfm5 UTSW 7 104154462 missense probably damaging 0.99
R5930:Olfm5 UTSW 7 104154155 missense probably damaging 1.00
R6416:Olfm5 UTSW 7 104154053 missense probably damaging 1.00
R7126:Olfm5 UTSW 7 104159980 missense probably damaging 1.00
R7535:Olfm5 UTSW 7 104154237 missense possibly damaging 0.92
R7682:Olfm5 UTSW 7 104161772 missense probably null 0.49
R7835:Olfm5 UTSW 7 104154445 nonsense probably null
R7918:Olfm5 UTSW 7 104154445 nonsense probably null
R8308:Olfm5 UTSW 7 104154399 missense probably damaging 1.00
X0011:Olfm5 UTSW 7 104153946 missense possibly damaging 0.91
Z1088:Olfm5 UTSW 7 104154150 missense probably damaging 1.00
Predicted Primers
Posted On2015-03-25