Incidental Mutation 'R3774:Olfr667'
ID273506
Institutional Source Beutler Lab
Gene Symbol Olfr667
Ensembl Gene ENSMUSG00000056782
Gene Nameolfactory receptor 667
SynonymsGA_x6K02T2PBJ9-7546146-7545166, MOR34-2, MOR34-11
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104914742-104921482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104916906 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 130 (Y130F)
Ref Sequence ENSEMBL: ENSMUSP00000150340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071362] [ENSMUST00000217177]
Predicted Effect probably benign
Transcript: ENSMUST00000071362
AA Change: Y130F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000100470
Gene: ENSMUSG00000056782
AA Change: Y130F

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 4.9e-102 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1.2e-8 PFAM
Pfam:7tm_1 43 295 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211111
Predicted Effect probably benign
Transcript: ENSMUST00000217177
AA Change: Y130F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Olfr667
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02707:Olfr667 APN 7 104916652 missense probably damaging 1.00
R0457:Olfr667 UTSW 7 104916973 missense probably benign 0.19
R0684:Olfr667 UTSW 7 104916634 missense probably benign 0.21
R1343:Olfr667 UTSW 7 104916627 missense probably damaging 1.00
R1401:Olfr667 UTSW 7 104916756 missense probably damaging 1.00
R1415:Olfr667 UTSW 7 104916336 missense probably benign 0.03
R1644:Olfr667 UTSW 7 104916808 missense probably benign 0.02
R1907:Olfr667 UTSW 7 104917065 missense probably damaging 0.99
R2063:Olfr667 UTSW 7 104916775 missense probably benign 0.02
R4751:Olfr667 UTSW 7 104916410 nonsense probably null
R4958:Olfr667 UTSW 7 104916461 missense probably damaging 0.97
R4960:Olfr667 UTSW 7 104916708 missense probably benign 0.02
R5362:Olfr667 UTSW 7 104916627 missense probably damaging 1.00
R5988:Olfr667 UTSW 7 104916918 missense probably damaging 0.98
R7396:Olfr667 UTSW 7 104916351 missense probably benign
R8169:Olfr667 UTSW 7 104916412 missense possibly damaging 0.60
Z1088:Olfr667 UTSW 7 104916666 missense probably benign 0.06
Z1177:Olfr667 UTSW 7 104917119 missense possibly damaging 0.82
Predicted Primers
Posted On2015-03-25