Incidental Mutation 'R3774:Kif23'
ID273511
Institutional Source Beutler Lab
Gene Symbol Kif23
Ensembl Gene ENSMUSG00000032254
Gene Namekinesin family member 23
SynonymsMKLP-1, Knsl5, C87313, 3110001D19Rik, MKLP1, CHO1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location61915905-61946774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61924992 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 623 (S623L)
Ref Sequence ENSEMBL: ENSMUSP00000034815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034815] [ENSMUST00000214295]
Predicted Effect probably benign
Transcript: ENSMUST00000034815
AA Change: S623L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000034815
Gene: ENSMUSG00000032254
AA Change: S623L

DomainStartEndE-ValueType
KISc 23 444 6.56e-147 SMART
Blast:KISc 524 607 8e-20 BLAST
low complexity region 661 678 N/A INTRINSIC
low complexity region 681 693 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
Pfam:MKLP1_Arf_bdg 796 899 9.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213595
Predicted Effect probably benign
Transcript: ENSMUST00000214295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216812
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Kif23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Kif23 APN 9 61926468 missense probably benign 0.19
IGL00814:Kif23 APN 9 61937107 missense possibly damaging 0.95
IGL01295:Kif23 APN 9 61932129 missense possibly damaging 0.89
IGL01521:Kif23 APN 9 61919900 missense probably damaging 0.99
IGL01583:Kif23 APN 9 61935468 missense probably damaging 1.00
IGL01680:Kif23 APN 9 61931814 missense probably benign 0.17
IGL02450:Kif23 APN 9 61923957 missense probably benign 0.00
IGL02698:Kif23 APN 9 61925001 missense possibly damaging 0.49
IGL03152:Kif23 APN 9 61929776 splice site probably benign
IGL03233:Kif23 APN 9 61926453 missense probably benign 0.05
H8562:Kif23 UTSW 9 61924065 missense probably benign
R0225:Kif23 UTSW 9 61925694 splice site probably benign
R0419:Kif23 UTSW 9 61926405 nonsense probably null
R0512:Kif23 UTSW 9 61918975 splice site probably benign
R0731:Kif23 UTSW 9 61925032 missense possibly damaging 0.67
R0980:Kif23 UTSW 9 61936764 missense possibly damaging 0.93
R1315:Kif23 UTSW 9 61923988 unclassified probably null
R1347:Kif23 UTSW 9 61927156 missense probably damaging 0.99
R1347:Kif23 UTSW 9 61927156 missense probably damaging 0.99
R1451:Kif23 UTSW 9 61924802 missense probably damaging 1.00
R1624:Kif23 UTSW 9 61925700 splice site probably null
R1820:Kif23 UTSW 9 61926438 missense possibly damaging 0.67
R1867:Kif23 UTSW 9 61918961 missense possibly damaging 0.87
R1937:Kif23 UTSW 9 61946610 critical splice donor site probably null
R2001:Kif23 UTSW 9 61927384 nonsense probably null
R2002:Kif23 UTSW 9 61927384 nonsense probably null
R2310:Kif23 UTSW 9 61924144 missense probably damaging 1.00
R2680:Kif23 UTSW 9 61937476 missense probably benign 0.25
R3196:Kif23 UTSW 9 61931911 nonsense probably null
R3775:Kif23 UTSW 9 61924992 missense probably benign 0.00
R3776:Kif23 UTSW 9 61924992 missense probably benign 0.00
R4349:Kif23 UTSW 9 61932114 missense probably damaging 1.00
R4671:Kif23 UTSW 9 61945359 missense probably benign 0.04
R4981:Kif23 UTSW 9 61931871 missense probably damaging 1.00
R4983:Kif23 UTSW 9 61936703 missense probably benign 0.01
R5685:Kif23 UTSW 9 61945409 missense probably benign 0.12
R5721:Kif23 UTSW 9 61944216 missense probably benign 0.45
R6903:Kif23 UTSW 9 61927154 missense possibly damaging 0.77
R7067:Kif23 UTSW 9 61924989 missense probably benign 0.01
R7103:Kif23 UTSW 9 61919892 missense probably damaging 0.99
R7456:Kif23 UTSW 9 61937120 missense probably benign 0.09
R7468:Kif23 UTSW 9 61937175 nonsense probably null
Z1177:Kif23 UTSW 9 61924163 missense possibly damaging 0.93
Predicted Primers
Posted On2015-03-25