Incidental Mutation 'R3774:Mon1a'
ID273512
Institutional Source Beutler Lab
Gene Symbol Mon1a
Ensembl Gene ENSMUSG00000032583
Gene NameMON1 homolog A, secretory traffciking associated
Synonyms2810468K17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3774 (G1)
Quality Score188
Status Not validated
Chromosome9
Chromosomal Location107888151-107903139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107901303 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 242 (Y242C)
Ref Sequence ENSEMBL: ENSMUSP00000141516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035202] [ENSMUST00000191906]
Predicted Effect probably damaging
Transcript: ENSMUST00000035202
AA Change: Y242C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035202
Gene: ENSMUSG00000032583
AA Change: Y242C

DomainStartEndE-ValueType
Pfam:Mon1 151 555 1.2e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158380
Predicted Effect probably damaging
Transcript: ENSMUST00000191906
AA Change: Y242C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141516
Gene: ENSMUSG00000032583
AA Change: Y242C

DomainStartEndE-ValueType
Pfam:Mon1 146 461 1.1e-138 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Mon1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Mon1a APN 9 107902684 missense probably damaging 1.00
IGL02104:Mon1a APN 9 107901615 missense probably damaging 1.00
IGL02223:Mon1a APN 9 107901285 missense probably damaging 1.00
IGL02268:Mon1a APN 9 107901798 missense possibly damaging 0.95
R1334:Mon1a UTSW 9 107901363 missense probably damaging 0.99
R1708:Mon1a UTSW 9 107898718 missense probably benign 0.27
R1753:Mon1a UTSW 9 107901363 missense probably damaging 0.99
R4964:Mon1a UTSW 9 107902651 missense probably damaging 1.00
R4966:Mon1a UTSW 9 107902651 missense probably damaging 1.00
R5586:Mon1a UTSW 9 107898695 missense probably damaging 0.99
R5636:Mon1a UTSW 9 107901240 missense probably damaging 1.00
R6816:Mon1a UTSW 9 107900410 missense probably damaging 1.00
R7080:Mon1a UTSW 9 107901786 missense probably damaging 1.00
R7709:Mon1a UTSW 9 107900128 missense probably benign 0.05
R7820:Mon1a UTSW 9 107901312 missense probably damaging 1.00
R8263:Mon1a UTSW 9 107898794 missense probably benign
RF009:Mon1a UTSW 9 107901234 missense probably damaging 1.00
Predicted Primers
Posted On2015-03-25