Incidental Mutation 'R3774:Sept8'
ID273513
Institutional Source Beutler Lab
Gene Symbol Sept8
Ensembl Gene ENSMUSG00000018398
Gene Nameseptin 8
SynonymsSepl
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53519257-53549565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53537579 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 352 (V352A)
Ref Sequence ENSEMBL: ENSMUSP00000113038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108987] [ENSMUST00000117061] [ENSMUST00000120878] [ENSMUST00000121334] [ENSMUST00000142800] [ENSMUST00000147912]
Predicted Effect probably damaging
Transcript: ENSMUST00000108987
AA Change: V352A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104615
Gene: ENSMUSG00000018398
AA Change: V352A

DomainStartEndE-ValueType
Pfam:Septin 41 314 1.9e-101 PFAM
Pfam:MMR_HSR1 46 191 5.7e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117061
AA Change: V352A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112920
Gene: ENSMUSG00000018398
AA Change: V352A

DomainStartEndE-ValueType
Pfam:Septin 41 314 6.5e-101 PFAM
Pfam:MMR_HSR1 46 191 1.3e-6 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120878
AA Change: V350A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113775
Gene: ENSMUSG00000018398
AA Change: V350A

DomainStartEndE-ValueType
Pfam:Septin 41 312 6.4e-98 PFAM
Pfam:MMR_HSR1 46 190 6.3e-7 PFAM
low complexity region 349 372 N/A INTRINSIC
low complexity region 377 392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121334
AA Change: V352A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113038
Gene: ENSMUSG00000018398
AA Change: V352A

DomainStartEndE-ValueType
Pfam:Septin 41 314 1.9e-100 PFAM
Pfam:MMR_HSR1 46 187 2.6e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142800
SMART Domains Protein: ENSMUSP00000124057
Gene: ENSMUSG00000018398

DomainStartEndE-ValueType
Pfam:Septin 1 51 5.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145927
Predicted Effect probably damaging
Transcript: ENSMUST00000147912
AA Change: V352A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120427
Gene: ENSMUSG00000018398
AA Change: V352A

DomainStartEndE-ValueType
Pfam:Septin 41 314 2.1e-101 PFAM
Pfam:MMR_HSR1 46 190 6e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit myelin outfoldings and reduced nerve conduction velocity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Sept8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Sept8 APN 11 53531996 missense probably benign 0.08
IGL01649:Sept8 APN 11 53535028 missense possibly damaging 0.79
IGL02131:Sept8 APN 11 53537857 missense possibly damaging 0.79
IGL02547:Sept8 APN 11 53537265 missense probably damaging 1.00
R0856:Sept8 UTSW 11 53537870 missense probably benign 0.01
R0908:Sept8 UTSW 11 53537870 missense probably benign 0.01
R1799:Sept8 UTSW 11 53534483 missense probably benign 0.32
R4747:Sept8 UTSW 11 53536718 missense probably damaging 1.00
R4810:Sept8 UTSW 11 53534589 missense probably damaging 0.97
R5034:Sept8 UTSW 11 53534438 missense probably damaging 1.00
R5313:Sept8 UTSW 11 53535982 missense probably damaging 1.00
R5652:Sept8 UTSW 11 53537217 missense probably damaging 1.00
R6263:Sept8 UTSW 11 53548383 missense probably benign 0.00
R6285:Sept8 UTSW 11 53534767 intron probably null
R6289:Sept8 UTSW 11 53534478 missense probably damaging 0.99
R6571:Sept8 UTSW 11 53537163 missense probably damaging 1.00
R7238:Sept8 UTSW 11 53536692 missense possibly damaging 0.68
R7249:Sept8 UTSW 11 53535122 missense probably damaging 0.97
R7646:Sept8 UTSW 11 53537917 critical splice donor site probably null
R7691:Sept8 UTSW 11 53537587 missense probably benign 0.00
X0024:Sept8 UTSW 11 53536724 nonsense probably null
X0058:Sept8 UTSW 11 53535085 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACTTGCTATCTCAGGCCTG -3'
(R):5'- ATTCGCTTCAGGTGCTCAAAC -3'

Sequencing Primer
(F):5'- TGGTGGGAGCCCTGAGTC -3'
(R):5'- CAGGTGCTCAAACTTCTCATGGAG -3'
Posted On2015-03-25