Incidental Mutation 'R3774:Krt32'
ID273516
Institutional Source Beutler Lab
Gene Symbol Krt32
Ensembl Gene ENSMUSG00000046095
Gene Namekeratin 32
SynonymsmHa2, Krt1-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3774 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100080848-100088226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100088121 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 36 (C36R)
Ref Sequence ENSEMBL: ENSMUSP00000103042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103127] [ENSMUST00000107419]
Predicted Effect probably benign
Transcript: ENSMUST00000103127
SMART Domains Protein: ENSMUSP00000099416
Gene: ENSMUSG00000048013

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
Filament 96 407 3.32e-159 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107419
AA Change: C36R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103042
Gene: ENSMUSG00000046095
AA Change: C36R

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
Filament 100 411 5.4e-150 SMART
low complexity region 435 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173988
Meta Mutation Damage Score 0.0938 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,933,097 V213A probably benign Het
Ccndbp1 A G 2: 121,009,100 K26R possibly damaging Het
Chrna10 T C 7: 102,114,328 T87A probably benign Het
Col27a1 T A 4: 63,314,726 N360K probably benign Het
Crispld2 T C 8: 120,029,266 S325P probably damaging Het
Dgkd T A 1: 87,936,300 I79N probably damaging Het
Dhdh T A 7: 45,481,938 D157V probably benign Het
Dnajc15 A T 14: 77,856,937 probably null Het
Fbxo44 G T 4: 148,156,594 F179L probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Itgav A G 2: 83,791,964 E630G probably damaging Het
Iws1 T C 18: 32,079,995 S159P probably damaging Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mon1a A G 9: 107,901,303 Y242C probably damaging Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Olfm5 T A 7: 104,161,849 R27S possibly damaging Het
Olfr667 T A 7: 104,916,906 Y130F probably benign Het
Palmd T C 3: 116,927,663 E81G probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Phf11b A G 14: 59,326,057 L137S probably benign Het
Phlpp1 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC 1: 106,393,191 probably benign Het
Plcb4 A G 2: 135,958,145 K472E probably benign Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Pomt1 A G 2: 32,244,250 H261R possibly damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rad23b C T 4: 55,382,589 T264I possibly damaging Het
Rfc1 T C 5: 65,264,406 Y1050C probably damaging Het
Sept8 T C 11: 53,537,579 V352A probably damaging Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Ssh1 T C 5: 113,966,722 D12G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Trpm3 T A 19: 22,987,975 S1611R probably benign Het
Ttyh3 A G 5: 140,648,734 F32L probably damaging Het
Unkl T A 17: 25,188,407 probably null Het
Vwf T A 6: 125,649,099 probably null Het
Wdr11 T A 7: 129,631,693 probably null Het
Yeats2 A G 16: 20,150,495 D12G probably damaging Het
Other mutations in Krt32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Krt32 APN 11 100087779 missense probably benign 0.23
IGL01454:Krt32 APN 11 100084081 missense probably damaging 1.00
IGL02268:Krt32 APN 11 100088141 missense probably benign 0.21
IGL02502:Krt32 APN 11 100087923 missense probably damaging 1.00
IGL02967:Krt32 APN 11 100084050 missense possibly damaging 0.93
IGL02799:Krt32 UTSW 11 100087907 missense possibly damaging 0.54
R0840:Krt32 UTSW 11 100081242 missense probably benign 0.00
R1503:Krt32 UTSW 11 100084110 critical splice acceptor site probably null
R1944:Krt32 UTSW 11 100084844 critical splice acceptor site probably null
R1945:Krt32 UTSW 11 100084844 critical splice acceptor site probably null
R2426:Krt32 UTSW 11 100086366 missense possibly damaging 0.76
R3775:Krt32 UTSW 11 100088121 missense probably benign 0.00
R3776:Krt32 UTSW 11 100088121 missense probably benign 0.00
R5522:Krt32 UTSW 11 100086671 critical splice donor site probably null
R5794:Krt32 UTSW 11 100084986 missense probably damaging 0.99
R6109:Krt32 UTSW 11 100087965 missense probably benign 0.01
R6994:Krt32 UTSW 11 100086445 missense probably damaging 1.00
R7375:Krt32 UTSW 11 100081224 missense probably benign 0.18
R7577:Krt32 UTSW 11 100081221 missense probably benign 0.00
R8249:Krt32 UTSW 11 100086722 missense probably benign 0.00
Z1088:Krt32 UTSW 11 100088216 missense probably benign
Z1177:Krt32 UTSW 11 100084069 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CATTGAAGGCACCCTCACAG -3'
(R):5'- CCATGAGAATACTTTAGTGCGAACC -3'

Sequencing Primer
(F):5'- GAACAGGCCATAGGTCCCCATG -3'
(R):5'- GAGAATACTTTAGTGCGAACCCCTTC -3'
Posted On2015-03-25